Skip to main content
. Author manuscript; available in PMC: 2022 Nov 4.
Published in final edited form as: Mol Cell. 2021 Sep 22;81(21):4481–4492.e9. doi: 10.1016/j.molcel.2021.08.034

KEY RESOURCES TABLE.

REAGENT OR RESOURCE SOURCE IDENTIFIER
Antibodies
Biotin Micro Beads Miltenyi Biotec Cat# 130-042-401
CD45-Biotin eBiosciences Cat# 13-0451-81
CD31-Biotin eBiosciences Cat# 13-0319-80
Cleaved Caspase 3 Cell Signaling Technologies Cat# 9664
Di-methyl lysine motif Cell Signaling Technologies Cat# 14117
ERK1/2 Cell Signaling Technologies Cat# 4695
Phospho-ERK1/2 Cell Signaling Technologies Cat# 4376
FLAG Sigma-Aldrich Cat# F1804
Histone H3 EpiCypher Cat# 13-0001
H3K36me1 Abclonal Cat# A2364
H3K36me2 ThermoFisher Cat# MA5-14867
H3K36me3 ThermoFisher Cat# MA5-24687
H3K27me2 Cell Signaling Technologies Cat# 9728S
H3K27me3 ThermoFisher Cat# MA5-11198
H4K20me2 Cell Signaling Technologies Cat# 9759S
H4K20me3 Cell Signaling Technologies Cat# 5737S
H3K9me2 ThermoFisher Cat# 710815
γH2AX ThermoFisher Cat# MA5-33062
Ki67 BD Bioscience Cat# 550609
KRas Antibody (F234) Santa Cruz Biotechnology Cat# sc-30
NSD2 EpiCypher Cat# 13-0001
NSD2E1099K This study N/A
PTEN Cell Signaling Technologies Cat# 9188
Ter119-Biotin eBiosciences Cat# 13-5921-81
Tubulin Millipore Cat# 05-661
Peroxidase AffiniPure Donkey Anti-Mouse IgG (H+L) Jackson ImmunoResearch Cat# 715-035-151
Peroxidase AffiniPure Donkey Anti-Rabbit IgG (H+L) Jackson ImmunoResearch Cat# 711-035-152
Bacterial and Virus Strains
DH5 Thermo Fisher Scientific Cat# K4520-1
BL21 Thermo Fisher Scientific Cat# C6070-03
BL21-RIL Agilent Technologies Cat# 230240
Sf9 Thermo Fisher Scientific Cat# 12659017
Ad5-CMV-Cre Baylor College of Medicine, Viral Vector Production Core Cat# Ad5-CMV-Cre RRID:SCR_015037
Biological Samples
Human LUAD Tissue Array MD Anderson Pathology N/A
Chemicals, Peptides, and Recombinant Proteins
RPMI 1640 Medium Corning Cat# MT10040CV
DMEM Medium Corning Cat# MT10017CV
Fetal bovine serum Thermo Fisher Scientific Cat# 10500056
PBS Corning Cat# MT21031CV
HBSS Thermo Fisher Scientific Cat# 14025076
Trypsin-EDTA 0.25% Corning Cat# MT25053CI
Puromycin Thermo Fisher Scientific Cat# A1113802
Hygromycin B Corning Cat# 30240CR
G418 Sulfate Corning Cat# MT30234CI
Complete Protease Inhibitor Cocktail Sigma-Aldrich Cat# 4693159001
Phosphatase Inhibitor Cocktail Thermo Fisher Scientific Cat# 78420
TRIzol Reagent Invitrogen Cat# 15596018
Bovine Serum Albumin (BSA) Thermo Fisher Scientific Cat# BP9703100
Matrigel Corning Cat# 354248
L-Reduced glutathione Sigma-Aldrich Cat# G4251-25G
S-adenosyl-methionine New England Biolabs Cat# B9003S
S-Adenosyl-l-[methyl-3H] methionine American Radiolabeled Chemicals Cat# ART0288
TransIT-293 Mirus Bio Cat# MIR-2706
NP-40 Sigma-Aldrich Cat# I8896
Phenylmethylsulfonyl fluoride (PMSF) Sigma-Aldrich Cat# P7626
cOmplete, EDTA-free protease inhibitor Sigma-Aldrich Cat# 5056489001
Trametinib (GSK1120212) Selleckchem Cat# S2673
Tamoxifen Sigma-Aldrich Cat# T5648
Recombinant nucleosome Epicypher Cat# 16-0006
DMSO Sigma-Aldrich Cat# D5879
16% Formaldehyde (w/v) Sigma-Aldrich Cat# F8775
PVDF membrane (0.2 μm) BioRad Cat# 1620177
PVDF membrane (0.45 μm) Millipore Cat# IPVH00010
Glutathione Sepharose 4B Sigma-Aldrich Cat# GE17-0756-01
Coomassie Plus Assay Thermo Fisher Scientific Cat# 23236
Coomassie GelCode Blue Thermo Fisher Scientific Cat# 24590
Polybrene Sigma-Aldrich Cat# TR-1003-G
Hydroxypropyl methylcellulose Sigma-Aldrich Cat# 09963
Doxycycline hyclate diet Envigo Teklad Cat# TD.01306
Recombinant STAT3 protein Active Motif Cat# NC1851469
Critical Commercial Assays
RNeasy Mini Kit Qiagen Cat# 74106
ZymoPURE Plasmid Miniprep Kit Zymo Cat# D4211
ZymoPURE II Plasmid Maxiprep Kit Zymo Cat# D4203
DNA PCR Purification Kit Qiagen Cat# 28106
DAB Substrate Kit Abcam Cat# ab64238
Vectastain ABC kit Vector Laboratories Cat# PK-6100
BCA Protein Assay Kit Pierce Cat# 23227
ECL Substrate Amersham Cat# RPN2106
PCR Mycoplasma Test Kit I/C PromoKine Cat# PK-CA91-1096
Site-directed mutagenesis kit Agilent Cat# 200523
Superscript First-strand Synthesis kit Invitrogen Cat# 18091050
Bac-to-Bac Baculovirus Expression System Thermo Fisher Scientific Cat# 10359016
PowerUP SYBR Green Thermo Fisher Scientific Cat# A25742
Qiagen MinElute PCR purification kit Qiagen Cat# 28004
NEBNext Ultra II DNA Library Prep Kit Illumina Cat# NEB E7645L
Deposited Data
RNA-seq and CUT&RUN This study GEO accession # GSE171218
Original Blot Images Data This study Mendeley Data DOI: DOI: 10.17632/4ns5ffk8fg.1
Experimental Models: Cell Lines
Human: A549 ATCC Cat# CRL- CCL-185
Human: U2OS ATCC Cat# CRL- HTB-96
Human: HT1080 ATCC Cat# CCL-121
Human: 293T ATCC Cat# CRL-3216
Mouse: Kras (KrasG12D) This study N/A
Mouse: KN (Kras;NSD2E1099K) This study N/A
Experimental Models: Organisms/Strains
Mouse: KrasLSL-G12D (Hingorani et al., 2003) Strain# JAX 008179
Mouse: p53LoxP/LoxP (Jonkers et al., 2001) Strain# JAX 008462
Mouse: Rosa26LSL-Nsd2(E1099K) This study N/A
Mouse: H11LSL-dCas9-KRAB-MeCP2; CAG-rtTA This study N/A
Mouse: NOD.SCID-IL2Rg−/− (NSG) The Jackson Laboratories Strain# 005557
Oligonucleotides
sgRNA non-targeting (control) 5’-CTTCGAAATGTCCGTTCGGT-3’ This study N/A
sgRNA Nsd2 human 5’- ACTCGTTAACAAATTCTCCCTGG 3’ This study N/A
sgRNA dCas9-KM Ci-Nsd2 5’- CGTTGCAGCGTAGGTCACTG-3’ This study N/A
sgRNA dCas9-KM Ci-Control 5’-GCGAGGTATTCGGCTCCGCG-3’ This study N/A
RT-qPCR Fosl1 forward 5’-CTAAGTGCAGAAACCGAAGAAAG 3’ This study N/A
RT-qPCR Fosl1 reverse 5’- CTTCTGCAGCTCTTCAATCTCTC-3’ This study N/A
RT-qPCR Jun forward 5’- TGGGCACATCA CCACTACAC-3’ This study N/A
RT-qPCR Jun reverse 5’- TCTGGCTATGCAGTTCAGCC -3’ This study N/A
RT-qPCR Actb forward 5’-TCGTACCACAGGCATTGTGATGG-3’ This study N/A
RT-qPCR Actb reverse 5’- GCAATGCCTGGGTACATGGTGG-3’ This study N/A
RT-qPCR Kras forward 5’- GGAGTACAGTGCAATGAGGGAC-3’ This study N/A
RT-qPCR Kras reverse 5’- CCAGGACCATAGGCACATCTTC-3’ This study N/A
ChIP-qPCR Fosl1 forward 5’- CCCCCGTGGTGCAAGTGGTT-3’ This study N/A
ChIP-qPCR Fosl1 reverse 5’- CGCGCCTCTCGGAGTCTGGT -3’ This study N/A
ChIP-qPCR Jun forward 5’- GCCATCCACAAATCCTCCCTGA -3’ This study N/A
ChIP-qPCR Jun reverse 5’- GCACAAGTGGGAAGTAACCCTA -3’ This study N/A
ChIP-qPCR GAPDH forward 5’- TAAGTCCCACAGCACCACAT -3’ This study N/A
ChIP-qPCR GAPDH reverse 5’- AGCATCTTTGTGACTGGGGA -3’ This study N/A
Recombinant DNA
Plasmid: pLentiCRISPRv2 Feng Zhang Lab Cat# Addgene #52961
Plasmid: pCMV-dR8.2 dvpr Bob Weinberg Lab Cat# Addgene #8455
Plasmid: pCMV-VSV-G Bob Weinberg Lab Cat# Addgene #8454
Plasmid: pBABE-neo Bob Weinberg Lab Cat# Addgene #1767
Plasmid: pGEX-6P-1 GE Healthcare Cat# 28-9546-48
Plasmid: pENTR3C Thermo Fisher Scientific Cat# A10465
Plasmid: pLenti CMV Hygro DEST (w117-1) Campeau and Kaufman lab Cat# Addgene 17454
Software and Algorithms
Prism 7 GraphPad https://www.graphpad.com/; RRID:SCR_002798
Excel for Mac 2016 Microsoft https://www.microsoft.com/en-us/; RRID:SCR_016137
PreciPoint M8 ViewPoint PreciPoint http://www.precipoint.com/microscopy-software/viewpoint/
ImageJ – Fiji package Freeware http://fiji.sc; RRID:SCR_002285
Origin Pro 8 Microcal https://www.originlab.com/ RRID:SCR_002815
DeepTools (3.5.0) (Ramirez et al., 2016) https://deeptools.readthedocs.io/en/latest/content/list_of_tools.html
Samtools (1.9) (Li et al., 2009) http://www.htslib.org/doc/samtools.html
Bamtools (2.3.0) (Barnett et al., 2011) https://github.com/pezmaster31/bamtools
Picard (1.96) Picard Toolkit, 2019. Broad Institute, GitHub Repository https://broadinstitute.github.io/picard/
FeatureCounts (Liao et al., 2014) http://subread.sourceforge.net
Gene Set Enrichment Analysis (GSEA) (4.1.0) (Subramanian et al., 2005) https://www.gsea-msigdb.org/gsea/index.jsp
Bowtie2 (2.2.7) (Langmead and Salzberg, 2012) http://bowtie-bio.sourceforge.net/bowtie2/index.shtml
HTSeq (Anders et al., 2015) https://htseq.readthedocs.io/en/release_0.11.1/count.html
HISAT2 (2.2.1) (Kim et al., 2015) https://daehwankimlab.github.io/hisat2
DESeq2 (Love et al., 2014) (https://bioconductor.org/packages/release/bioc/html/DESeq2.html
Trim_galore (0.6.5) Babraham Bioinformatics http://www.bioinformatics.babraham.ac.uk/projects/trim_galore