Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2022 Feb 2.
Published in final edited form as: Anal Chem. 2021 Jan 11;93(4):2351–2358. doi: 10.1021/acs.analchem.0c04221

Ligation-enabled fluorescence-coding PCR for high-dimensional fluorescence-based nucleic acid detection

Joon Soo Park , Thomas Pisanic , Ye Zhang , Tza-Huei Wang †,‡,§,*
PMCID: PMC8574133  NIHMSID: NIHMS1750644  PMID: 33427441

Abstract

Polymerase chain reaction (PCR) is by far the most commonly-used method of nucleic acid amplification and has likewise been employed for a plethora of diagnostic purposes. Nonetheless, multiplexed PCR-based detection schemes have hitherto been largely limited by technical challenges associated with nonspecific interactions and other limitations, inherent to traditional fluorescence-based assays. Here we describe a novel strategy for multiplexed PCR-based analysis called Ligation-eNabled fluorescence-Coding PCR (LiNC PCR) that exponentially enhances the multiplexing capability of standard fluorescence-based PCR assays. The technique relies upon a simple, preliminary ligation reaction in which target DNA sequences are converted to PCR template molecules with distinct end-point fluorescence signatures. Universal TaqMan probes are used to create target-specific multi-color fluorescence signals that can be readily decoded to identify amplified targets of interest. We demonstrate the LiNC PCR technique by implementing a 2-color-based assay for detection of 10 ovarian cancer epigenetic biomarkers at analytical sensitivities as low as 60 template molecules with no detectable target crosstalk. Overall, LiNC PCR provides a simple and inexpensive method for achieving high-dimensional multiplexing that can be implemented in manifold molecular diagnostic applications.

Graphical Abstract

graphic file with name nihms-1750644-f0005.jpg

1. Introduction

The development of molecular diagnostic techniques has been a bedrock of modern medicine12, allowing detection and monitoring of various diseases through detection of genomic3 and proteomic markers at high sensitivity and specificity.4 Of all available nucleic acid techniques, polymerase chain reaction (PCR)5 is the most commonly implemented, providing a simple and inexpensive means of amplifying trace amounts of target genetic material.67 The high sensitivity, specificity, and reproducibility of PCR have led to its ubiquitous use in a wide range of clinical diagnostic applications, such as pathogen identification,6, 8 cancer detection,7, 9 and many others. Recent advances in the development of automated,1012 miniaturized,13 and ultrafast1415 PCR techniques have also enabled the implementation of diagnostic assays in settings ranging from centralized laboratories to point-of-care.

Yet despite these significant advances, PCR-based approaches remain hampered by a limited ability to simultaneously detect a high number of targets. This issue largely stems from the fact that most PCR-based assays are reliant upon fluorescence-based detection schemes that are ultimately limited by the spectral bandwidth of fluorescent probes.1617 The most commonly-employed method for achieving simultaneous detection of multiple DNA targets is the use of sequence-specific fluorescently-labeled oligonucleotide probes such as molecular beacons18 or TaqMan probes.19 This traditional, one-color-one-target, probe-based detection scheme fundamentally limits the multiplexing capacity of assays to detection of no more than four to six target sequences per assay. More recently, alternative schemes aimed at increasing the multiplex capability of PCR-based assays have been developed. One such approach, termed multicolor combinational probe coding (MCPC), employs a scheme by which each target sequence is encoded with different combinations of multiple fluorophores, theoretically providing discrimination of up to 2n – 1 targets in a single assay, where n is number of independently-resolvable fluorophores.2021 A similar approach was used for detection of multiple pathogens by color-coded molecular beacons, where unique combinations of two out of six differently colored molecular beacons were employed.22 Although a considerable improvement over traditional fluorescent PCR approaches, the MCPC and color-coded molecular beacons are still fundamentally limited to no more than four to six colors, thereby precluding higher-dimensional multiplexed analyses. Another reported strategy is to encode each target with different fluorescence intensities within the same channel.2324 With this approach, different end-point fluorescence intensities are generated by varying the relative concentrations of different fluorescently-labeled probes. Drawbacks to this approach include the need to fine-tune numerous primer and probe sequences and concentrations in order to obtain the desired end-point fluorescence intensities while limiting nonspecific amplification and amplification biases.2526 More recently, we also introduced a novel multiplexing scheme that addresses many of the primary issues associated with the use of multiple sets of probes.27 Here, multiplex nucleic acid detection is achieved by coupling padlock probe chemistry28 with rolling circle amplification (RCA) or hyperbranched rolling circle amplification (HRCA),2930 to generate specific fluorescence ratios by concurrent hybridization of multiple fluorescently-labeled probes.

In the present work, we sought to build upon and adapt this multi-probe hybridization paradigm to more traditional and widely-used PCR assays. To achieve this, here we develop a novel, fluorescence-based color-coding PCR scheme called LiNC PCR (Ligation-eNabled fluorescence-Coding PCR) that can be employed to dramatically increase the multiplexing potential of standard PCR-based assays. Target discrimination is achieved in the LiNC PCR method by incorporating a simple preliminary ligation reaction that converts target DNA into color-coded templates. PCR amplification of the ligation product is subsequently performed using a single set of universal primers and fluorescently-labeled probes, drastically simplifying assay design and reducing the risk of nonspecific amplification caused by multiple primer sets. Amplified targets can be identified by characteristic end-point fluorescence signals that reflect the number of TaqMan probe binding sites pre-assigned to each respective target. Here, we demonstrate the concept and potential of LiNC PCR method by achieving detection of a panel of ten ovarian cancer epigenetic biomarkers31 using only two universal TaqMan probes. We also further detail proper design of the ligation pairs (LPs) and systematic optimization of reaction conditions to maximize performance while minimizing crosstalk between the respect target-assays. Overall, we demonstrate that LiNC PCR provides a facile and flexible method for incorporating high dimensional multiplexed detection for PCR-based assays.

2. Experimental Section

2.1. Materials and Reagents.

All DNA oligonucleotides used in this study including ligation pairs (LPs), universal primers, LNA-modified fluorescently labeled DNA probes, and synthetic targets were purchased from Integrated DNA Technologies, Inc. (Coralville, IA, USA). Reagents for ligation including 9°N DNA ligase, and 10X 9°N DNA ligase reaction buffer were purchased from New England BioLabs, Inc. (Ipswich, MA, USA, catalog #: M0238S). Polyethylene glycol-6000 (PEG-6000) as a ligation additive was purchased from Sigma-Aldrich Corp. (St. Louis, MO, catalog #: 528877). Human male genomic DNA was purchased from Promega Corp. (Madison, WI, catalog #: G1471). PCR reagents including TaKaRa Taq HS, 10X PCR buffer, and dNTP Mixture were purchased from Takara Bio USA, Inc. (Mountain View, CA, catalog #: R007A). The 384-well plate was purchased from Corning Inc. (Corning, NY, catalog #: 3540).

2.2. Experimental procedures for LiNC PCR reaction.

Step 1: Hybridization and ligation.

The ligation reaction was performed in 10 μL of ligation mixture containing a mixture of LPs in a range of 1 pM to 50 pM for each strand (optimal condition was determined to be 1 pM for the mixture of 10 LPs), synthetic DNA targets (at different concentrations), 1.5 units/μL 9°N DNA ligase, and 1X 9°N DNA ligase reaction buffer (10 mM Tris-HCl pH 7.5, 600 μM ATP, 2.5 mM MgCl2, 2.5 mM Dithiothreitol, 0.1% Triton X-100). 5% (w/v) PEG-6000 was used as an additive to improve ligation efficiency.32 The reaction was performed in a PCR Express Thermal Cycler (ThermoFisher Scientific, Waltham, MA) for 10 cycles of 95°C for 30 s, and 55°C for 20 min.

For PCR optimization, ligation was performed in 10 μL reaction mixture containing one pair of LP (50 pM of each strand), 10 fM target, 5% (w/v) PEG-6000, 1.5 units/μL 9°N DNA ligase, and 1X 9°N DNA ligase reaction buffer (10 mM Tris-HCl pH 7.5, 600 μM ATP, 2.5 mM MgCl2, 2.5 mM Dithiothreitol, 0.1% Triton X-100). The reaction was performed in a PCR Express Thermal Cycler for 10 cycles of 95°C for 30 s, and 55°C for 20 min.

Step 2: Polymerase chain reaction (PCR) and end-point fluorescence detection.

Subsequent PCR reaction containing 0.04 units/μL TaKaRa Taq HS, 1X PCR buffer (10 mM Tris-HCl pH 8.9, 50 mM KCl, 1.5 mM MgCl2), 0.2 mM dNTP, universal primers at different concentrations in a range of 100 nM to 700 nM (optimal concentration was determined to be 100 nM), 600 nM Alexa Fluor 555 (AF555)-labeled DNA probe, 600 nM 6-Carboxyfluorescein (FAM)-labeled DNA probe, and 1 μL ligation product at a final volume of 10 μL was carried out using a CFX96 Touch™ Real-time PCR Detection System (Bio-Rad, Hercules, CA). The reaction was initiated with Taq polymerase activation at 95°C for 1 min, followed by 60 or 80 cycles of 95°C for 30 s, 60°C for 30 s, and 72°C for 30 s (optimal cycle number was determined to be 80 cycles). Each PCR product was then pipetted into a well of a 384-well plate containing 30 μL H2O, and the end-point fluorescence intensities generated by AF555 and FAM were separately measured using a Amersham Typhoon 5 scanner (GE Healthcare, Chicago, IL). The excitation and emission wavelengths used for fluorescence detection were 532 nm and 570 nm for AF555, and 488 nm and 525 nm for FAM, respectively. The photomultiplier tube (PMT) voltages for each fluorescence were 500 V for AF555, and 350 V for FAM. For data analysis, the fluorescence intensities measured by Amersham Typhoon 5 were quantified by ImageQuantTL software (GE Healthcare, Chicago, IL).

3. Results and discussion

3.1. Overview of the LiNC PCR method.

LiNC PCR requires only two steps: ligation and PCR amplification. Ligation is accomplished using designated ligation pairs (LPs) targeting each respective DNA sequence or locus of interest (LOI) in the multiplex assay. Each LP consists of an upstream (5’) “left” arm and a corresponding downstream (3’) “right” arm. The tail of each arm includes a predefined, target-specific number of TaqMan probe binding sites and a universal primer handle for downstream amplification (Figure 1A). The terminal residue at the 5’ end of each right arm is phosphorylated to enable ligation via a phosphodiester bond with the corresponding 3’-hydroxyl end in the left arm. In the presence of target template DNA, each LP is hybridized to its complementary target sequence and covalently linked by ligation. As a result, each target sequence is converted into a corresponding PCR template containing a target-specific fluorescence code. Amplification is then performed via standard TaqMan PCR that generates a distinct end-point fluorescence reflective of the amplified target. Target identification is then accomplished by transforming fluorescent signal intensities into geometric space (here, two dimensional) that can be used to decode the target according to its characteristic fluorescence signature (Figure 1B).

Figure 1. Schematic illustration of LiNC PCR.

Figure 1.

(A) The ligation pairs (LPs) each consist of a 5’-left arm and a corresponding 3’-right arm containing target complementary regions, universal primer sites, and varying numbers of red and green fluorescent probe binding sites, specific to each target. As a proof of concept, ten LPs are designed to include zero to four red and/or green probe binding sites to accomplish a ten-target assay using only two fluorescent probes. (B) LiNC PCR is performed using only two steps: a ligation reaction followed by TaqMan PCR reaction to generate distinct fluorescence signals in accordance with the predesigned fluorescence codes. End-point fluorescence intensities are then measured to identify the targets detected within the sample.

3.2. Ligation pair (LP) design

As a proof of concept for the present study, we began by designing LPs targeting ten ovarian cancer epigenetic biomarkers (Table 1), which we previously identified as highly-specific biomarkers of high-grade serous ovarian cancer.31 Each LP included zero to four red and/or green TaqMan probe binding sites to achieve ten distinct fluorescence signatures using only two fluorescent probes (Figure 1, Table S1). The two TaqMan probes were labeled with 6-Carboxyfluorescein (FAM) and Alexa Fluor 555 (AF555), respectively, and each contained five locked nucleic acid (LNA) residues to improve relative affinity towards their complementary strands (Table S2).3334 The increased hybridization efficiency of LNA probes enables the use of PCR probes of shorter length than standard probes, leading to a higher signal-to-noise ratio due to better fluorescence quenching efficiency. Additionally, incorporation of LNA bases in the PCR probe increases the specificity of the probes due to improved mismatch discrimination ability.3536

Table 1.

Synthetic target sequences of epigenetic biomarkers

Target UCSC RefGene Name DNA Sequence (5’ → 3’) Genomic location
A C17orf64 TTTTTTCGCGTTTTTGGGCGGTATACGGCGGGGTTTCGGCGA chr17 60421612:60421653
(42nt, − strand)
B OTX2OS1 AGTCGGGTTTCGGTTCGGGTTCGGTTTGGGGTTGGGGATTTCG chr14 56812031:56812073
(43nt, + strand)
C PCDHGA6 GCGGTAGCGTAGATTCGTTATTTTATTTTCGAGGAGTTGGAGAAAGGTTTTTTCG chr5 141374162:141374216
(55nt, + strand)
D IRX2 CGTTTATCGGTTTCGCGTTGTTGTCGTCGTTATCGTTATTTCGTCGTCGT chr5 2751575:2751624
(50nt, − strand)
E ZNF706 GCGAGAGGGTCGGGAGAGGACGTCGGAGGGAAAGGAAGGGG chr8 101205474:101205514
(41nt, + strand)
F LOC200726 GCGGAGTTGGGTTTTAATTTTGTAGTTTTCGTCGTATCGGTACGTATTCGCGA chr2 206642102:206642154
(53nt, + strand)
G TUBB6 GGATTTTGGCGCGTTTTTTTAGGCCGAAGCGTATTTTTTCGTTAACGCG chr18 12307557:12307605
(49nt, + strand)
H KCNK2 GGTTACGAGGGCGAGGAGGACGTTTTAGTGTAGGGGTTTAAGGATTCG chr1 215082353:215082400
(48nt, + strand)
I PTPRN TGCGTTATATATGGCGTAAGAGTTTTGTCGGAGCGGGGGATTTATTTAGTTTATT chr2 219309527:219309581
(55nt, + strand)
J NEUROD1 TAGATTAGAGCGAGTGGTTTGTTTTCGCGTCGGAAGTAGGATAGAGGTGAAAG chr2 181681014:181681066
(53nt, + strand)

LiNC PCR requires implementation of a proper LP design strategy to achieve exclusive amplification of ligation products and reliable generation of corresponding fluorescence signatures. Most importantly, we found that color-probe binding sites in one arm of the LPs should not be present in the other to avoid exponentially-generated, nonspecific amplification signals from the PCR reaction (Figure S1). Nonetheless, there is no fundamental limitation to the number of fluorophore binding sites or species that can be incorporated into a LiNC assay so long as the probe binding sites for each respective fluorophore species are placed in only one of the LP arms. In the current work, we restricted ourselves to two fluorophore species only for illustrative purposes.

3.3. Identifying ideal primer to probe ratios

We next aimed to identify PCR reaction conditions that maximize the accuracy, consistency, and differentiability of target-specific fluorescence signatures. In contrast to traditional qPCR assays, the LiNC PCR paradigm suggests that each assay must contain higher concentrations of fluorescent probe compared to the primers in order to account for the multiple probe binding sites for each fluorescence signature. Furthermore, for proper target discrimination, amplification rather than probe consumption must be saturated so that end-point signals are differentiable, evenly separated and reflective of the number of probe binding sites for each target.

We investigated the impact of relative TaqMan probe/primer concentration upon LiNC PCR performance using a model system of six DNA targets, each with a corresponding LP and distinct fluorescence code containing no more than four red or green probe binding sites (Figure 2). PCR amplification was performed while varying the relative concentrations of TaqMan probes and primer to observe the effects these parameters have on target discrimination performance. Specifically, we modulated the relative TaqMan probe/primer concentration between 0.86X to 6X by varying the primer concentration from 700 nM to 100 nM with a fixed TaqMan probe concentration of 600 nM and observed the resulting endpoint fluorescence values. The results indicated that at a primer concentration of 700 nM, when the primer concentration exceeded the TaqMan probe concentration, end-point fluorescence signals from the six targets were not clearly differentiable (Figure 2A). Furthermore, the observed fluorescence ratios were notably inaccurate, as evidenced by high normalized root mean square errors (NRMSE; Figure S2). Accordingly, as the primer concentration was reduced to 300 nM, with a probe excess of 2X, six target-specific fluorescence signals became distinguishable (Figure 2B) and the NRMSE decreased. Further reduction in the primer concentration down to 100 nM, a probe excess of 6X, resulted in well-distributed fluorescent signatures in accordance with the respective numbers of target binding sites (Figure 2C) and minimal NRMSE, indicating the production of accurate fluorescence codes. Overall, these results underscore the conclusion that the fluorescent probe concentrations must be greater than the primer concentration times the number of the respective probe binding sites in order to account for full PCR amplification. Based on these results, 100 nM and 600 nM were selected as primer and color-probe concentrations, respectively, for the PCR stage of the LiNC PCR method. It is worth noting that there are no fundamental restrictions on the TaqMan probe and primer concentrations, so long as the primer to probe ratio can account for the total number of TaqMan probe binding sites for any amplified target.

Figure 2. Impact of relative probe/primer concentration in LiNC PCR on target discrimination based on end-point fluorescence intensity.

Figure 2.

PCR-generated TaqMan fluorescence for 6 fluorescence signatures at relative probe/primer concentrations of (A) 0.86X, (B) 2X, and (C) 6X. Blue: target-specific end-point fluorescence signals by LiNC PCR; Black: PCR background signal where PCR is performed without ligation reaction.

3.4. Optimization of ligation reaction.

We next aimed to optimize the ligation reaction condition to minimize generation of non-target-specific ligation products. We found that proper LP concentration is important for avoiding target-independent nonspecific ligation. To this end, we performed ligation reactions in the absence of targets while titrating the concentration of the ten LPs. We then performed PCR amplification and observed the formation of nonspecific products, as indicated by fluorescence generated by nonspecific TaqMan reactions. We observed that nonspecific background signal gradually diminished as the LP concentration was reduced and became undetectable at LP concentrations of 1 pM or less (Figure S3). This phenomenon is common to ligation-based PCR techniques and is ostensibly due to random collisions between the 5’-phosphorylated end of right arms and 3’-hydroxyl end of left arms caused by highly congested LPs. While salmon sperm DNA has previously been used as a carrier to mitigate signal by suppressing random LP collisions,3738 our results indicate that nonspecific ligation can also be effectively reduced or eliminated without using additional reagents by simply reducing LP concentrations.

We next evaluated whether target-specific signal could be retained at lower LP concentrations by using two targets possessing distinct fluorescence codes and observing end-point fluorescence as a function of LP concentrations between 10 pM and 1 pM. The end-point fluorescence intensity plots show that the target-specific signals (blue dots) were independent of the LP concentration over this range, while the nonspecific signal (red dots) could be reduced down to the PCR background (black dots) at an LP concentration of 1 pM (Figure 3). Based on these results, the optimal concentration of each LP was determined to be 1 pM for the LiNC PCR assay.

Figure 3. Effect of LP concentration on formation of nonspecific ligation products in LiNC PCR.

Figure 3.

Ligation reactions were performed while varying the LP concentrations of (A) 10 pM, (B) 5 pM, and (C) 1 pM, followed by PCR amplification. Fluorescence from nonspecific ligation products (red dots) is present at LP concentrations of both (A) 10 pM and (B) 5 pM, but not at concentrations of (C) 1 pM. Target-specific signals (blue dots) remain unaffected over this range of LP concentrations. Black dots indicate the background fluorescence signal when no ligation reaction is performed.

3.5. Influence of PCR cycle number on end-point fluorescence.

PCR cycle number was also identified as an important parameter for achieving distinct end-point fluorescence signals, especially at low target concentrations (e.g. 1 fM). In particular, target-assays with more than two probe binding sites exhibited diminished end-point fluorescence intensities at 60 PCR cycles. Analysis of the real-time PCR curves with a target possessing three probe binding sites indicated that 60 PCR cycles were insufficient for reaching the PCR plateau phase at concentrations of 1 fM or less, whereas a target with one probe binding site was fully amplified at 60 PCR cycles (Figure S4A). To address this issue, we performed LiNC PCR with 10 different color codes and monitored the real-time fluorescence signals over 80 PCR cycles to determine the number of cycles necessary to reach the plateau phase for all fluorescence ratios. Overall, the results indicated that the total number of cycles required to reach the plateau is proportional to the number of TaqMan binding sites of the respective fluorophore. The necessity for higher number of cycles in LiNC PCR is possibly due to reduced PCR efficiency arising from the need for Taq-based exonuclease digestion of all bound TaqMan probes to achieve successful amplicon replication in each respective cycle. In our system, 80 cycles were sufficient to reach the plateau level in assays with up to 4 TaqMan binding sites (Figure S4B). However, more cycles would likely be required when designing target-assays with 5 or more binding sites.

3.6. Validation of a ten-target, two-color LiNC PCR assay.

Lastly, we implemented the optimized parameters to develop a single LiNC PCR assay capable of detecting and identifying the ten ovarian cancer epigenetic biomarker sequences shown in Table 1, while using only a single pair of universal primers and two fluorescent probes. To demonstrate this assay, we mixed 1 fM of one of each of the ten synthetic targets with the master mix containing all ten LPs and then measured the red and the green fluorescence intensities following the PCR reaction step. The results of this analysis showed that the detected fluorescent codes provided unambiguous target identification by accurately reflecting each unique red to green fluorescence signature (Figure 4A). The 10-target LiNC PCR assay was also analytically validated by serial dilution of synthetic targets at concentrations ranging from 1 fM (6000 copies) down to 1 aM (6 copies). Overall, the analytical sensitivity of the LiNC PCR assay was target dependent and ranged from 10 aM to 1 fM, or 60 to 6,000 copies (Figure S5), however all 10 targets could be accurately and reliably geometrically identified at concentrations of 1 fM or greater (Figure 4B). The observed range in analytical sensitivity is likely due to variance in the hybridization efficiencies during the ligation portion of the assay.

Figure 4. Ten-target LiNC PCR using two fluorescent probes.

Figure 4.

(A) End-point fluorescence image obtained from the LiNC PCR by employing 1 fM of each of ten ovarian cancer methylation biomarker targets (Table 1). NTC refers to the LiNC PCR signals without target, and PCR refers to the PCR background signals where PCR is performed without ligation reaction. (B) Detected red and green fluorescence signals for each respective LiNC PCR target (blue dots). The vertical and horizontal error bars represent standard deviations of red and green fluorescence signals, respectively. LiNC PCR background signal in the absence of target with and without the ligation step are shown by the red and black dots, respectively.

To further demonstrate the potential of LiNC PCR for diagnostic assays, we assessed analytical specificity by mixing each respective LP with a 10 fM mixture of the remaining nine targets. The results demonstrated absolute specificity with no detectable amplification of non-target DNA (Figure S6). Moreover, we further validated the applicability of LiNC PCR for use in biologically-relevant contexts by demonstrating detection of each of the ten targets spiked into a background of human genomic DNA (gDNA) or circulating cell-free DNA (cfDNA). The results show that all ten distinguishable fluorescence codes were readily resolvable in the two dimensional scatter plot, with no detectable signal with either gDNA or cfDNA as background (Figure S7, Figure S8). Finally, we demonstrated the ability to use LiNC PCR for target quantitation by performing LiNC PCR on titrations of Target A (c17orf64) ranging from 1 pM to 1 fM. The results, shown in Figure S9, show the anticipated inverse linear correlation between cycle of quantification (Cq) and logarithmic target concentration. Overall, this result suggests that LiNC PCR is readily amenable for the development of high-dimensional multiplexed quantitative PCR (qPCR)-based assays.

4. Conclusions

In this work, we developed a novel high-dimensional fluorescence detection scheme called LiNC PCR that can maximize the multiplex capability of conventional fluorescent probe-based PCR methods. LiNC PCR employs a unique ligation-based strategy that provides the ability to achieve specific detection of multiple targets,39 while using only a single set of universal primers and fluorescent probes. During the ligation step, each respective target sequence is encoded using color-specific TaqMan probe binding sites that generate a characteristic fluorescence signature during PCR that enable unambiguous identification of amplified targets. This approach results in a geometric, as opposed to a linear, increase in the number of possible targets achievable with respect the number of fluorescent probe colors employed in the assay. We demonstrated the potential of LiNC PCR for high-dimensional multiplexed detection by developing a single assay capable of detecting 10 ovarian cancer epigenetic biomarkers using only a single set of universal PCR primers and 2 TaqMan probes. The multiplex capability in the present method can be further enhanced by expanding the number of probe sites or fluorescent probe colors. For example, an additional ten or more targets could be readily assayed with the addition of more TaqMan probe color binding sites. The assay also achieved analytical sensitivities ranging from 10 aM to 1 fM, equivalent to 60 to 6,000 template molecules, without crosstalk between the individual target-assays.

We observed that the incorporation of multiple TaqMan probes for signal generation did somewhat reduce overall PCR efficiency, necessitating the use of a higher number of cycles to reach the PCR plateau phase. However, we note that overall assay time could likely be reduced though optimization of the PCR reaction (e.g. increasing the concentration of DNA polymerase40 or utilizing a DNA polymerase with stronger exonuclease activity41). While LiNC PCR can be performed using conventional TaqMan probes, incorporation of LNA sequences allows the use of shorter, more specific probes, thereby increasing the possible number of probe sites in each LP as well as improving the performance of the method by enhancing the signal-to-noise ratio.3334 It is worth noting that the LiNC PCR method demonstrated here for broad-based detection of target sequences, it is in principle readily-amenable, and ideally-suited, for use with digital PCR (dPCR)-based methods4243 to unlock the full multiplexing potential of the technique. Furthermore, digitization of LiNC PCR is also expected to improve overall analytic sensitivity down to the single molecule level through the elevation of local concentrations of template molecules that inherently result from sample partitioning in dPCR. Lastly, we note that, similar to other multi-step methods, the overall robustness of LiNC-PCR can be improved through use of contamination-free laboratory facilities with instrumentation specifically designed to prevent cross contamination during the transfer of samples between labware and instruments. With these considerations in mind, our results demonstrate LiNC PCR as a simple and versatile method for achieving highly multiplexed assays for manifold nucleic acid targets of interest.

Supplementary Material

Supporting Information

Acknowledgements

Research reported in this publication is financially supported by the National Institutes of Health (R01AI137272, R01AI138978, R01AI117032, NIH U01CA214165, NIH UG3CA211457) and the Honorable Tina Brozman Foundation

Footnotes

Supporting Information

Supplementary methods, sequence information of ligation pairs (LPs) for the 10-plex detection method and its corresponding color-codes, sequence information of universal primers and TaqMan probes, non-specific amplification caused by improper LP design, fluorescence signal deviation with respect to relative probe/primer concentration, effect of LP concentration on the formation of non-specific ligation products, effect of PCR cycle number and probe binding site number on generation of target fluorescence signal, comparison of the analytical sensitivities in the LiNC PCR assay for different targets, specificity of the ten-target LiNC PCR assay, LiNC PCR with genomic DNA background, LiNC PCR with circulating cell-free DNA background, and target titration of the LiNC PCR assay.

References

  • 1.Chiu RW; Lo YM; Wittwer CT, Molecular diagnostics: a revolution in progress. Clin Chem 2015, 61 (1), 1–3. [DOI] [PubMed] [Google Scholar]
  • 2.Poste G, Molecular diagnostics: a powerful new component of the healthcare value chain. Expert Rev Mol Diagn 2001, 1 (1), 1–5. [DOI] [PubMed] [Google Scholar]
  • 3.Netto GJ; Saad RD; Dysert PA 2nd, Diagnostic molecular pathology: current techniques and clinical applications, part I. Proc (Bayl Univ Med Cent) 2003, 16 (4), 379–83. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Walter G; Bussow K; Lueking A; Glokler J, High-throughput protein arrays: prospects for molecular diagnostics. Trends Mol Med 2002, 8 (6), 250–3. [DOI] [PubMed] [Google Scholar]
  • 5.Mullis KB; Faloona FA, Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction. Methods Enzymol 1987, 155, 335–50. [DOI] [PubMed] [Google Scholar]
  • 6.Yang S; Rothman RE, PCR-based diagnostics for infectious diseases: uses, limitations, and future applications in acute-care settings. Lancet Infect Dis 2004, 4 (6), 337–48. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Sokolenko AP; Imyanitov EN, Molecular Diagnostics in Clinical Oncology. Front Mol Biosci 2018, 5, 76. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Monis PT; Giglio S, Nucleic acid amplification-based techniques for pathogen detection and identification. Infect Genet Evol 2006, 6 (1), 2–12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Bernard PS; Wittwer CT, Real-time PCR technology for cancer diagnostics. Clin Chem 2002, 48 (8), 1178–85. [PubMed] [Google Scholar]
  • 10.Shin DJ; Athamanolap P; Chen L; Hardick J; Lewis M; Hsieh YH; Rothman RE; Gaydos CA; Wang TH, Mobile nucleic acid amplification testing (mobiNAAT) for Chlamydia trachomatis screening in hospital emergency department settings. Sci Rep 2017, 7 (1), 4495. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Smith K; Diggle MA; Clarke SC, Automation of a fluorescence-based multiplex PCR for the laboratory confirmation of common bacterial pathogens. J Med Microbiol 2004, 53 (Pt 2), 115–7. [DOI] [PubMed] [Google Scholar]
  • 12.Shin DJ; Trick AY; Hsieh YH; Thomas DL; Wang TH, Sample-to-Answer Droplet Magnetofluidic Platform for Point-of-Care Hepatitis C Viral Load Quantitation. Sci Rep 2018, 8 (1), 9793. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Zhang C; Xing D, Miniaturized PCR chips for nucleic acid amplification and analysis: latest advances and future trends. Nucleic Acids Res 2007, 35 (13), 4223–37. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Lee SH; Park SM; Kim BN; Kwon OS; Rho WY; Jun BH, Emerging ultrafast nucleic acid amplification technologies for next-generation molecular diagnostics. Biosens Bioelectron 2019, 141, 111448. [DOI] [PubMed] [Google Scholar]
  • 15.Ullerich L; Campbell S; Krieg-Schneider F; Bursgens F; Stehr J, Ultra-fast PCR technologies for point-of-care testing. Laboratoriumsmedizin-Journal of Laboratory Medicine 2017, 41 (5). [Google Scholar]
  • 16.Keller MA; Cassel DL; Rappaport EF; McKenzie SE; Schwartz E; Surrey S, Fluorescence-based RT PCR analysis: determination of the ratio of soluble to membrane-bound forms of Fc gamma RIIA transcripts in hematopoietic cell lines. PCR Methods Appl 1993, 3 (1), 32–8. [DOI] [PubMed] [Google Scholar]
  • 17.Luthra R; McBride JA; Hai S; Cabanillas F; Pugh WC, The application of fluorescence-based PCR and PCR-SSCP to monitor the clonal relationship of cells bearing the t(14;18)(q32;q21) in sequential biopsy specimens from patients with follicle center cell lymphoma. Diagn Mol Pathol 1997, 6 (2), 71–7. [DOI] [PubMed] [Google Scholar]
  • 18.Tyagi S; Kramer FR, Molecular beacons: probes that fluoresce upon hybridization. Nat Biotechnol 1996, 14 (3), 303–8. [DOI] [PubMed] [Google Scholar]
  • 19.Holland PM; Abramson RD; Watson R; Gelfand DH, Detection of specific polymerase chain reaction product by utilizing the 5′----3′ exonuclease activity of Thermus aquaticus DNA polymerase. Proc Natl Acad Sci U S A 1991, 88 (16), 7276–80. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Huang Q; Hu Q; Li Q, Identification of 8 foodborne pathogens by multicolor combinational probe coding technology in a single real-time PCR. Clin Chem 2007, 53 (10), 1741–8. [DOI] [PubMed] [Google Scholar]
  • 21.Huang Q; Zheng L; Zhu Y; Zhang J; Wen H; Huang J; Niu J; Zhao X; Li Q, Multicolor combinatorial probe coding for real-time PCR. PLoS One 2011, 6 (1), e16033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Marras SAE; Tyagi S; Antson DO; Kramer FR, Color-coded molecular beacons for multiplex PCR screening assays. PLoS One 2019, 14 (3), e0213906. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Zhong Q; Bhattacharya S; Kotsopoulos S; Olson J; Taly V; Griffiths AD; Link DR; Larson JW, Multiplex digital PCR: breaking the one target per color barrier of quantitative PCR. Lab Chip 2011, 11 (13), 2167–74. [DOI] [PubMed] [Google Scholar]
  • 24.Rajagopal A; Yurk D; Shin C; Menge K; Jacky L; Fraser S; Tombrello TA; Tsongalis GJ, Significant Expansion of Real-Time PCR Multiplexing with Traditional Chemistries using Amplitude Modulation. Sci Rep 2019, 9 (1), 1053. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Markoulatos P; Siafakas N; Moncany M, Multiplex polymerase chain reaction: a practical approach. J Clin Lab Anal 2002, 16 (1), 47–51. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Pan W; Byrne-Steele M; Wang C; Lu S; Clemmons S; Zahorchak RJ; Han J, DNA polymerase preference determines PCR priming efficiency. BMC Biotechnol 2014, 14, 10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Zhang Y; Chen L; Hsieh K; Wang TH, Ratiometric Fluorescence Coding for Multiplex Nucleic Acid Amplification Testing. Anal Chem 2018, 90 (20), 12180–12186. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Nilsson M; Malmgren H; Samiotaki M; Kwiatkowski M; Chowdhary BP; Landegren U, Padlock probes: circularizing oligonucleotides for localized DNA detection. Science 1994, 265 (5181), 2085–8. [DOI] [PubMed] [Google Scholar]
  • 29.Liu D; Daubendiek SL; Zillman MA; Ryan K; Kool ET, Rolling Circle DNA Synthesis: Small Circular Oligonucleotides as Efficient Templates for DNA Polymerases. J Am Chem Soc 1996, 118 (7), 1587–1594. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Baner J; Nilsson M; Mendel-Hartvig M; Landegren U, Signal amplification of padlock probes by rolling circle replication. Nucleic Acids Res 1998, 26 (22), 5073–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Pisanic TR 2nd; Cope LM; Lin SF; Yen TT; Athamanolap P; Asaka R; Nakayama K; Fader AN; Wang TH; Shih IM; Wang TL, Methylomic Analysis of Ovarian Cancers Identifies Tumor-Specific Alterations Readily Detectable in Early Precursor Lesions. Clin Cancer Res 2018, 24 (24), 6536–6547. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Xiao ZX; Cao HM; Luan XH; Zhao JL; Wei DZ; Xiao JH, Effects of additives on efficiency and specificity of ligase detection reaction. Mol Biotechnol 2007, 35 (2), 129–33. [DOI] [PubMed] [Google Scholar]
  • 33.Petersen M; Wengel J, LNA: a versatile tool for therapeutics and genomics. Trends Biotechnol 2003, 21 (2), 74–81. [DOI] [PubMed] [Google Scholar]
  • 34.Bonetta L, Prime time for real-time PCR. Nature Methods 2005, 2 (4), 305–311. [Google Scholar]
  • 35.Owczarzy R; You Y; Groth CL; Tataurov AV, Stability and mismatch discrimination of locked nucleic acid-DNA duplexes. Biochemistry 2011, 50 (43), 9352–67. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.You Y; Moreira BG; Behlke MA; Owczarzy R, Design of LNA probes that improve mismatch discrimination. Nucleic Acids Res 2006, 34 (8), e60. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Barany F, Genetic disease detection and DNA amplification using cloned thermostable ligase. Proc Natl Acad Sci U S A 1991, 88 (1), 189–93. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Cheng Y; Zhao J; Jia H; Yuan Z; Li Z, Ligase chain reaction coupled with rolling circle amplification for high sensitivity detection of single nucleotide polymorphisms. Analyst 2013, 138 (10), 2958–63. [DOI] [PubMed] [Google Scholar]
  • 39.Landegren U; Kaiser R; Sanders J; Hood L, A ligase-mediated gene detection technique. Science 1988, 241 (4869), 1077–80. [DOI] [PubMed] [Google Scholar]
  • 40.McNevin D; Edson J; Robertson J; Austin JJ, Reduced reaction volumes and increased Taq DNA polymerase concentration improve STR profiling outcomes from a real-world low template DNA source: telogen hairs. Forensic Sci Med Pathol 2015, 11 (3), 326–38. [DOI] [PubMed] [Google Scholar]
  • 41.Kreuzer KA; Bohn A; Lass U; Peters UR; Schmidt CA, Influence of DNA polymerases on quantitative PCR results using TaqMan probe format in the LightCycler instrument. Mol Cell Probes 2000, 14 (2), 57–60. [DOI] [PubMed] [Google Scholar]
  • 42.Vogelstein B; Kinzler KW, Digital PCR. Proc Natl Acad Sci U S A 1999, 96 (16), 9236–41. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Pohl G; Shih Ie M, Principle and applications of digital PCR. Expert Rev Mol Diagn 2004, 4 (1), 41–7. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supporting Information

RESOURCES