Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Genotyping primers and sgRNAs sequences.
| Name | Sequence | Used for |
|---|---|---|
| sgRNA I | ctcttgtcttctaggagaaa | sgRNA target site I |
| sgRNA II | gactactacgtgcctagagg | sgRNA target site II |
| Bex2 F | ggatggatgggcgttagtcc | F primer genotyping |
| Bex2 R | gctcaggactcagggcataa | R primer genotyping |
| Bex2 qF | atcgtgcactacagatgggac | qRT-PCR F |
| Bex2 qR | tccaaagtggaacaaggcgtg | qRT-PCR R |
| U6 F | gaggcctatttcccatgatt | sgRNA ligation confirmation |
