KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Primary: rabbit anti-SYCP3 | Abcam | Cat# ab15093; RRID: AB_301639 |
| Primary: mouse anti-MLH1 | Abcam | Cat# ab14206: RRID: AB_300987 |
| Secondary: goat anti-rabbit IgG H&L Alexa488 | Abcam | Cat# ab150077; RRID: AB_2630356 |
| Secondary: goat anti-mouse IgG H&L Alexa555 | Abcam | Cat# ab150114; RRID: AB_2687594 |
| Chemicals, peptides, and recombinant proteins | ||
| Tricaine methanesulfonate (MS 22) | Sigma-Aldrich | Cat# E10521 |
| 2-phenoxyethanol | Sigma-Aldrich | Cat# 77699 |
| Ribonuclease A from bovine pancreas | Sigma-Aldrich | Cat# R6513 |
| Formamide | Sigma-Aldrich | Cat# 47671 |
| Cas9 protein | Tacgene | No reference |
| Hematoxylin | Microm Microtech | Cat# F/HAQ999 |
| Mountant and DAPI (4′,6-diamidino-2-phenolindole) | Cambio | Cat# 1124-MD-1250 |
| Spectrum-Orange-dUTP | Vysis | Cat# 02N33-050 |
| Spectrum-Green-dUTP | Vysis | Cat# 02N32-050 |
| Bovine Serum Albumin (BSA) | Vector | Cat# SP-5050 |
| Pepsin | Chemos CZ | Cat# A4289.0100 |
| Giemsa stain | Giemsa stain | Giemsa stain |
| Critical commercial assays | ||
| NucleoSpin plasmid DNA purification kit | Machery-Nagel | Cat# 740588.50 |
| NucleoSpin Kits for Tissue | Machery-Nagel | Cat# 740952.50 |
| HiDi Taq DNA polymerase | myPOLS Biotec | No reference |
| AccuPrime Taq DNA polymerase | Thermofisher | Cat# 12339016 |
| AccuPrime Taq DNA Polymerase, High Fidelity | Thermofisher | Cat# 12346086 |
| TOPO TA cloning Kit XL | Thermofisher | Cat# K8050-20 |
| ProLong Gold Antifade Mountant | Thermofisher | Cat# P10144 |
| MAXIscript T7 Transcription Kit | Thermofisher | Cat# AM1312 |
| Jumpstart Taq DNA polymerase | Sigma-Aldrich | Cat# D9307 |
| Chromium Genome Reagent Kits v2 | 10X genomics | Cat# PN-120258 |
| KAPA library Amplification kit | Roche Diagnostics | Cat# KK2620 |
| Kapa Library Quantification Kit | Roche Diagnostics | Cat# KK4824 |
| Illumina HiSeq3000 sequencing kits | Illumina | Cat# FC-410-101 |
| Illumina NovaSeq Reagent Kits | Illumina | Cat# 20012860 |
| Truseq DNA PCR-Free kit | Illumina | Cat# 20015962 |
| TruSeq Nano DNA HT Library Prep Kit | Illumina | Cat# 20015965 |
| SP flow cell | Illumina | Cat# 20027464 |
| S4 Novaseq flow cell | Illumina | Cat #20012866 |
| AMPure XP beads | Beckman Coulter | Cat# A63881 |
| Nanopore Ligation Sequencing Kit | Oxford Nanopore | Cat# SQK-LSK109 |
| SMRTbell Express Template Prep Kit 2.0 | PacBio | Cat# 101-685-400 |
| Binding kit 2.0 kit | PacBio | Cat# 102-089-000 |
| Sequencing kit 2.0 | PacBio | Cat# 101-829-200 |
| Arima-HiC kit | Arima | Cat# 510008 |
| Cy3 NT Labeling Kit | Jena Bioscience | Cat# PP-305L-CY3 |
| Multiplex Fluorescent Reagent Kit v2 | ACD Biotechne | Cat# 323100 |
| MagAttract HMW DNA kit (48) | QIAGEN | Cat# 67563 |
| Deposited data | ||
| Structure of proprotein complex of human GDF2 | 55 | PDB: 4YCG |
| Structure of the proprotein complex of human activin A | 56 | PDB: 5HLY |
| Structure of the growth factor domain of human GDF5 in complex with repulsive guidance molecule B | 57 | PDB: 6Z3J |
| Structure of the growth factor domain of human GDF5 in complex with repulsive guidance molecule B and neogenin | 57 | PDB: 6Z3M |
| Structure of the growth factor domain of human GDF5 in complex with BMP receptor 1A | 58 | PDB: 3QB4 |
| Pachón cavefish, Astyanax mexicanus, genome assembly and annotation | This study | GenBank: PRJNA734455 |
| Experimental models: Organisms/strains | ||
| A. mexicanus Pachón cavefish wild-type | Jeffery laboratory, University of Maryland, College Park, MD | N/A |
| A. mexicanus Pachón cavefish gdf6b KO | This study | N/A |
| Oligonucleotides | ||
| Primers for the amplification of the gdf6b FISH Probe, see Data S1E | Eurofins | N/A |
| Primers for B genotyping, see Data S1E | Eurofins | N/A |
| Primers for screening gdf6b-KO, see Data S1E | Eurofins | N/A |
| Primers for RT-QPCR for gdf6b, see Data S1E | Eurofins | N/A |
| Forward primer containing sgRNAs target sequences for #site 1 GAAATTAATACGACTCACTATAGGAGTCTGAAACCGGTTCTGGTTTTAGAGCTAGAAATAGCAAG | Eurofins | N/A |
| Forward primer containing sgRNAs target sequences for #site 2 GAAATTAATACGACTCACTATAGGGAGCTGGGCTGGGACGACGTTTTAGAGCTAGAAATAGCAAG | Eurofins | N/A |
| Universal Reverse primer: AAAAGCACCGACTCGGTGCCACT | Eurofins | N/A |
| Truseq DNA UD Indexes | Illumina | Cat# 20020590 |
| DOP primer (10 μM) GAGGATGAGGTTGAGNNNNNNGTGG | KRD, Prague, Czech Republic | N/A |
| RNAScope probe for cavefish Gdf6b | ACD Biotechne | N/A |
| RNAScope probe for cavefish gsdf | ACD Biotechne | N/A |
| Recombinant DNA | ||
| DR274 vector | 59 | Addgene plasmid #42250 |
| Gdf6b genomic FISH probe | This study | N/A |
| Software and algorithms | ||
| Hifiasm version 0.9 | 60 | https://github.com/chhylp123/hifiasm |
| Long Ranger v2.1.1 | 10X Genomics | https://support.10xgenomics.com/genome-exome/software/pipelines/latest/advanced/other-pipelines |
| Juicer | 61 | https://github.com/aidenlab/juicer |
| 3D-DNA pipeline | 62 | https://github.com/aidenlab/3d-dna |
| Juicebox | 62 | https://github.com/aidenlab/Juicebox/wiki/Juicebox-Assembly-Tools |
| Minimap2 v2.11 | 63 | https://github.com/lh3/minimap2 |
| RepeatModeler | Smit, AFA, Hubley, R. Unpublished | http://www.repeatmasker.org/ |
| RepeatMasker | Smit, AFA, Hubley, R & Green, P. Unpublished | http://www.repeatmasker.org/ |
| Genewise | 64 | https://www.ebi.ac.uk/seqdb/confluence/display/THD/GeneWise |
| Exonerate | European Bioinformatics Institute. Unpublished | https://www.ebi.ac.uk/about/vertebrate-genomics/software/exonerate |
| Hisat | 65 | http://www.ccb.jhu.edu/software/hisat/index.shtml |
| StringTie | 66 | https://ccb.jhu.edu/software/stringtie/ |
| Trinity | 67 | https://github.com/trinityrnaseq/trinityrnaseq/wiki |
| Pasa | 68 | https://github.com/PASApipeline/PASApipeline/wiki |
| Augustus | 69 | https://github.com/Gaius-Augustus/Augustus |
| karyoploteR | 70 | https://bernatgel.github.io/karyoploter_tutorial/ |
| Primer3web software version 4.1.0 | 71 | https://primer3.ut.ee/ |
| NovaSeq Control Software and Real-Time Analysis component (v3.4.4) | PacBio | N/A |
| Illumina’s conversion software (bcl2fastq v2.20) | Illumina | N/A |
| FastQC (v0.11.8) | 72 | https://github.com/s-andrews/FastQC |
| BWA mem version 0.7.17 | 73 | https://github.com/lh3/bwa |
| Picard tools version 2.18.2 | Broad Institute | http://broadinstitute.github.io/picard |
| samtools mpileup version 1.8 | 74 | https://sourceforge.net/projects/samtools/files/samtools/ |
| popoolation2 | 75 | https://sourceforge.net/projects/popoolation2/ |
| PSASS version 2.0.0 | Feron R. unpublished | https://doi.org/10.5281/zenodo.2615936 |
| Yasara | 76 | http://www.yasara.org |
| Yasara hm_build.mcr macro | 76 | http://www.yasara.org/hm_build.mcr |
| RStudio (Open Source version) | RStudio team | http://www.rstudio.com/ |
| Ikaros software | MetaSystems | N/A |
| DP Manager imaging software | Olympus | N/A |
| Olympus Acquisition Software | Olympus | N/A |
| Adobe Photoshop CS6 | Adobe | N/A |
| ZiFiT software | 77 | http://zifit.partners.org/ZiFiT/Disclaimer.aspx |
| Other | ||
| Nalgene Freezing Container (Mr. Frosty) | Merck | Cat# C1562-1EA |
| Megaruptor1 system | Diagenode | Cat# B06010001 |
| Qubit3 fluorometer Invitrogen | ThermoFisher | Cat# Q33216 |
| poly-l-lysine slides | ThermoFisher | Cat# J2800AMNZ |
| BluePippin Size Selection system | Sage Science | No reference |
| M220 Focused-ultrasonicator | Covaris | Cat# 500295 |
| Sequence data a whole genome assembly of Pachón | This study | PRJNA734455 |