TABLE 2.
Sequences of oligonucleotides used for single PCR and their localization on the virus genomea
| Primer | Sense | Sequence (5′–3′) | Genomic position | Template | % Homology between PCV-1 and PCV-2 |
|---|---|---|---|---|---|
| ORF1.PCV1.S1 | + | GCCAAGCAAGAAAAGC | 47–63 | ORF1 | 93 |
| ORF1.PCV1.S2 | + | GAGGTGGGTGTTCACCCT | 82–97 | ORF1 | 94 |
| ORF1.PCV1.AS1 | − | CGTTACAGGGAACTGCTC | 445–462 | ORF1 | 89 |
| ORF1.PCV1.AS2 | − | GTGTACAGCTGTCTTCCAATC | 527–547 | ORF1 | 86 |
| ORF1.PCV1.AS5 | − | GTGGATTGTTCTCCAGCAGTC | 892–912 | ORF1 | 86 |
| ORF1.PCV1.AS6 | − | CACACAGTCTCAGTAGATCATCC | 706–728 | ORF1 | 100 |
| ORF2.PCV2.S4 | + | CACGGATATTGTAGTCCTGGT | 1093–1114 | ORF2 | 36 |
| ORF2.PCV2.AS4 | + | CCGCACCTTCGGATATACTGTC | 1565–1586 | ORF2 | 31 |
Nucleotide sequences and localization on the PCV-1 or PCV-2 genome were given in reference to the sequences of the prototype ATCC CCL-33 strain of PCV-1 (GenBank accession no. 49186) (23) and the sequences of the PMWS-associated PCV-2 strain isolated in Manitoba, Canada (GenBank accession no. AF027217) (14).