Skip to main content
. 2021 Oct 22;21(21):7015. doi: 10.3390/s21217015

Table 1.

SARS-CoV-2 genome sequences with the highest PQS and G-scores were obtained from patients from 23 countries from 5 continents.

Genome Region Position Length QGRS 1 G-Score Total of Genomes Analyzed Genomes with PQS Conservation Level (%)
ORF1ab 1,574 26 GGTGTTGTTGGAGAAGGTTCCGAAGG 19 211,072 207,006 98.07
13,385 20 GGTATGTGGAAAGGTTATGG 18 210,888 99.91
S 24,215 20 GGTTGGACCTTTGGTGCAGG 17 211,072 210,803 99.87
24,268 24 GGCTTATAGGTTTAATGGTATTGG 19 210,999 99.97
25,197 22 GGCCATGGTACATTTGGCTAGG 17 207,837 98.47
N 28,903 15 GGCTGGCAATGGCGG 18 211,072 191,696 90.82

1 G-tracts are underlined.