Skip to main content
. Author manuscript; available in PMC: 2022 Aug 5.
Published in final edited form as: Cell. 2021 Jul 13;184(16):4251–4267.e20. doi: 10.1016/j.cell.2021.06.025

KEY RESOURCES TABLE

REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies
Goat polyclonal anti-DMC1 Santa Cruz Biotechnology Cat# sc-8973, RRID: AB_2091206 Discontinued
Mouse monoclonal anti-DMRT1 (SS6) Santa Cruz Biotechnology Cat# sc-101024, RRID: AB_2277252
Mouse monoclonal anti-SYCP3 (D-1) Santa Cruz Biotechnology sc-74569, RRID: AB_2197353
Rabbit polyclonal anti-STRA8 Abcam Cat# ab49602, RRID: AB_945678
Rabbit polyclonal anti-HORMAD1 GeneTex Cat# GTX119236, RRID: AB_11178755
Rabbit monoclonal anti-Phospho-Histone H2A.X (20E3) Cell Signaling Technology Cat# 9718, RRID: AB_2118009
Rabbit polyclonal anti-REC8 This paper N/A
Biological samples
Human testicular biopsy from cancer patient (Normal adjacent tissue) Folio Biosciences now Discovery Life Sciences biospecimen bank https://www.dls.com
Human testis Deidentified deceased donor – Washington Regional Transplant Community https://www.beadonor.org/
Chemicals, peptides, and recombinant proteins
2-mercaptoethanol Sigma-Aldrich Cat# M6250
Acetic acid Mallinckrodt Cat# 2504
Agarose Invitrogen Cat# 16500500
AMPure XP beads Beckman Coulter Cat# A63881
ATP solution 100 mM Thermo Fisher Scientific Cat# R0441
Chloroform-isoamyl alcohol mixture (24:1) Sigma-Aldrich Cat# C0549
cOmplete Mini Protease Inhibitor Cocktail Roche Cat# 11836153001
DAPI Sigma-Aldrich Cat# D8417
DNA Polymerase I Large (Klenow) Fragment New England Biolabs Cat# M0210
Dynabeads Protein G Thermo Fisher Scientific Cat# 10004D
EDTA 0.5 KD Medical Cat# RGF3130
EGTA Sigma-Aldrich Cat# E3889
Glycine MP Biomedicals Cat# 808822
Guanidinium thiocyanate Sigma-Aldrich Cat# G9277
HCl Mallinckrodt Cat# H613
IGEPAL-CA630 Sigma-Aldrich Cat# 18896
Klenow fragment (exo-) New England Biolabs Cat# M0212
KOH Sigma-Aldrich Cat# 5958
Lambda Exonuclease Thermo Fisher Scientific Cat# EN0561
LiCl 8M Sigma-Aldrich Cat# L7026
NaCl 5M KD Medical Cat# RGF3270
NaHCO3 Sigma Cat# S5761
NaOH Mallinckrodt Cat# 7708
Paraformaldehyde Sigma-Aldrich Cat# P6148
Phenol-chloroform-isoamyl alcohol mixture (25:24:1) Sigma-Aldrich Cat# 77617
Polynucleotide Kinase Thermo Fisher Scientific Cat# EK0031
Proteinase K New England Biolabs Cat# P8107S
Quick ligation kit New England Biolabs Cat# M2200
RNase Inhibitor, Murine New England Biolabs Cat# M0314
RNaseA/T1 Thermo Fisher Scientific Cat# EN0551
RNaseI Lucigen Cat# N6901K
Sarkosyl Sigma-Aldrich Cat# 61747
SDS 10% KD Medical Cat# RGE3230
Sodium Acetate pH = 5.2 3M Cellgro Cat# 46033CI
Sodium citrate Mallinckrodt Cat# 0754–12
Sodium deoxycholate monohydrate Sigma-Aldrich Cat# D5670
Sucrose MP Biomedicals Catt# 152584
T4 DNA Ligase Reaction Buffer New England Biolabs Cat# B0202
T4 DNA polymerase – SSDS library prep New England Biolabs Cat# M0203
Tris pH = 8.0 1M KD Medical Cat# RGF3360
Triton X-100 Sigma-Aldrich Cat# T9284
Critical commercial assays
DNAzol Thermo Fisher Scientific Cat# 10503027
Qiaquick PCR purification kit QIAGEN Cat# 28104
MinElute PCR purification kit QIAGEN Cat# 28004
Chromaspin TE-1000 Takara Cat# 636079
Qubit dsDNA HS Assay Kit Thermo Fisher Scientific Cat# Q32851
Click-iT EdU Alexa Fluor 488 Flow Cytometry Assay Kit Invitrogen Cat# C10420
TruSeq Nano DNA Low Throughput Library Prep Kit Illumina Cat# 20015964
KAPA HiFi HotStart Library Amplification Kit Roche Kit Code KK2620 Cat# 07958978001
KAPA Hyper Prep Kit Roche Kit Code KK8502 Cat# 07962347001
Deposited data
ATAC-Seq in mouse differentiated cKIT+ spermatogonia Maezawa et al., 2018 SRA:SRR5956508
ATAC-Seq in mouse embryonic stem cells GEO: GSE113428 SRA:SRR7048437,SRR7048438
ATAC-Seq in mouse embryonic stem cells at 6 Days GEO: GSE113428 SRA:SRR7048433,SRR7048434
ATAC-Seq in mouse hepatocytes Li et al., 2019 SRA:SRR6813698,SRR6813699
ATAC-Seq in mouse hindlimb muscle cells E14.5 Castro et al., 2019 SRA:SRR8104383,SRR8104391
ATAC-Seq in mouse mouse embryonic fibroblasts GEO: GSE113428 SRA:SRR7048429, SRR7048430
ATAC-Seq in mouse pachytene spermatocytes Maezawa et al., 2018 SRA:SRR5956512
ATAC-Seq in mouse undifferentiated THY+ spermatogonia Maezawa et al., 2018 SRA:SRR5956504
Crossover and non-crossover data for mouse Li et al., 2019 https://idp.nature.com/authorize?response_type=cookie&client_id=grover&redirect_uri=https%3A%2F%2Fwww.nature.com%2Farticles%2Fs41467-019-11675-y
Data from this study This study GEO:GSE148327
DMC1-SSDS in B10.F-H2pb1/(13R)J (13R) mice Smagulova et al., 2016 GEO:GSM1954833
DMC1-SSDS in C57BL6 mice (Rep T1) Brick et al., 2018 GEO:GSM2664275
DMC1-SSDS in C57BL6 mice (Rep T2) Brick et al., 2018 GEO:GSM2664276
DMC1-SSDS in C57BL6 mice with humanized PRDM9 allele Davies et al., 2016 GEO:GSM2049306
DMC1-SSDS in C57BL6 × castaneus F1 hybrid mice Smagulova et al., 2016 GEO:GSM1954839
DMC1-SSDS in C57BL6 × castaneus F1 hybrid mice Davies et al., 2016 GEO:GSM2049312
DMC1-SSDS in castaneus mice Smagulova et al., 2016 GEO:GSM1954846
DMC1-SSDS in Hop2−/− mice Brick et al., 2018 GEO:GSM3136743
DMC1-SSDS in Prdm9−/− mice Brick et al., 2018 GEO:GSM2664291
DMC1-SSDS in testis of PRDM9A homozygous human male (AA1) Pratto et al., 2014 SRA:SRR1528821
DMC1-SSDS in testis of PRDM9A homozygous human male (AA2) Pratto et al., 2014 SRA:SRR1528831
H3K4me3 ChIP-Seq in 12 dpp C57BL6 mice Baker et al., 2014 GEO:GSM1273023
H3K4me3 ChIP-Seq in C57BL6 mice with humanized PRDM9 allele Davies et al., 2016 GEO:GSM1904284
H3K4me3 ChIP-Seq in C57BL6 × castaneus F1 hybrid mice Baker et al., 2015 GEO:GSE60906
Hi-C data from Zygonema Patel et al., 2019 GEO:GSE122622
Input-SSDS in C57BL6 mice Brick et al., 2018 GEO:GSM2664289
Input-SSDS in testis of PRDM9A homozygous human male (AA1) Pratto et al., 2014 SRA:SRR1528822
Input-SSDS in testis of PRDM9A homozygous human male (AA2) Pratto et al., 2014 SRA:SRR1528832
Okazaki-fragment sequencing in mouse ESCs Petryk et al., 2018 SRA:SRR7535256
PRDM9 Affinity-Seq data Walker et al., 2015 GEO:GSE61613
Processed data at DMC1-SSDS hotspots in C57BL6 mice Brick et al., 2018 https://static-content.springer.com/esm/art%3A10.1038%2Fs41586-018-0492-5/MediaObjects/41586_2018_492_MOESM3_ESM.zip
Processed RT data from Human CyT49 Liver cells Zimmerman and Gilbert, 2018 ID: Int81158282; https://www2.replicationdomain.com/
Processed RT data from Human FM01–154-001 Myoblast cells Zimmerman and Gilbert, 2018 ID: Int58331187 ; https://www2.replicationdomain.com/
Processed RT data from Human GM06990 Lymphoblastoid cells Zimmerman and Gilbert, 2018 ID: Ext54054609; https://www2.replicationdomain.com/
Processed RT data from Human H7 ES Cells Zimmerman and Gilbert, 2018 ID: Ext35479608; https://www2.replicationdomain.com/
Processed RT data from human RPE1 cells Takahashi et al., 2019 GEO:GSM2904948
Processed RT data from Human U2OS Bone epithelial cells Zimmerman and Gilbert, 2018 ID: Int66343918 ; https://www2.replicationdomain.com/
Processed RT data from Mouse J185a Myoblast cells Zimmerman and Gilbert, 2018; Hiratani et al., 2010 ID: Int61896107; https://www2.replicationdomain.com/
Processed RT data from Mouse L1210 Lymphoblastoid cells Zimmerman and Gilbert, 2018; Hiratani et al., 2010 ID: Ext49892535; https://www2.replicationdomain.com/
SNS-Seq coverage in mouse ESCs (Almeida) Almeida et al., 2018 GEO:GSE99741
SNS-Seq coverage in mouse ESCs (rep 1) Cayrou et al., 2015 GEO:GSM1668878
SNS-Seq coverage in mouse ESCs (rep 2) Cayrou et al., 2015 GEO:GSM1668879
SNS-Seq coverage in mouse ESCs (rep 3) Cayrou et al., 2015 GEO:GSM1668880
SNS-Seq in human HELA cells Long et al., 2020 GEO:GSE134988
SNS-Seq peaks and initiation zones in mouse ESCs Cayrou et al., 2015 GEO:GSE68347
Spo11-oligo mapping data in mouse Lange et al., 2016 GEO:GSM2247727
WGS in activated mouse B cells Tubbs et al., 2018 GEO:GSM3227969
WGS in CD8+ T cells cells (S-phase) Yehuda et al., 2018 SRA:SRR7249814,SRR7249815,SRR7249816
WGS in mouse E14 ES-Cells (S-phase) Dey et al., 2015 SRA:SRR1639635
WGS in mouse primordial germ cells (S-phase) Yehuda et al., 2018 SRA:SRR6638995,SRR6638997,SRR6638999,SRR6639001,SRR6639003
WGS in mouse spermatogonial stem cells (S-phase) Yehuda et al., 2018 SRA:SRR6639005,SRR6639007,SRR6639009
WGS in non-replicating mouse B Cells Tubbs et al., 2018 GEO:GSM3227968
WGS in non-replicating mouse primordial germ cells Yehuda et al., 2018 SRA:SRR6639002
Crossovers in B6xCAST mice Yin et al., 2019 SRA: PRJNA511715
Experimental models: Cell lines
Mouse: Passage 10 129X1/SvJ-PRX-129X1 #1 mES cells The Jackson Laboratory RRID: CVCL_2H79
Experimental models: Organisms/strains
Mouse: C57BL/6J The Jackson Laboratory JAX: 000664
Mouse: CAST/Eij The Jackson Laboratory JAX: 000928
Mouse: Spo11−/− in C57BL/6J This paper N/A
Oligonucleotides
Guide RNA: Upstream spo11: TAGAGCGCGGAAAGGTTCGC This paper N/A
Guide RNA: Downstream spo11: CGAACCTTGAGAGGTTGCGA This paper N/A
Primer: Spo11NullF: CCTCCCTGAAGGGTAGTGTG This paper N/A
Primer: Spo11NullR: GAACGGAGCAGAAGAAGACG This paper N/A
Primer: Spo11Ex4R: CTCCCGGTGCTGAAATTAAA This paper N/A
Recombinant DNA
Plasmid: pSpCas9(BB)-2A-Puro (PX459) Ran et al., 2013 Addgene Plasmid #48139
Software and algorithms
BEDtools v.2.27.1 Quinlan and Hall, 2010 https://github.com/arq5x/bedtools2
BWA 0.7.12 Li, 2013 https://sourceforge.net/projects/biobwa/files/bwa-0.7.12.tar.bz2/download
DeepTools v.3.0.1 Ramírez et al., 2014 https://github.com/deeptools/deepTools
Juicer v.1.19.02 Durand et al., 2016) https://github.com/aidenlab/juicer
MACS v.2.1.2.1 Zhang et al., 2008 https://github.com/macs3-project/MACS
Nextflow v.20.01.0 Di Tommaso et al., 2017 https://github.com/nextflow-io/nextflow/releases
Picard v.2.9.2 Broad Institute of MIT and Harvard, 2018 https://broadinstitute.github.io/picard/
R v.3.6.0 R Core Team, 2014 https://www.r-project.org/
SAMtools v.1.9 Li et al., 2009 http://samtools.github.io/
SRA toolkit v.2.9.2 Leinonen et al., 2011 https://github.com/ncbi/sra-tools
UCSC toolkit v.396 Kent et al., 2010 https://github.com/ucscGenomeBrowser/kent
Analytical pipeline This paper https://zenodo.org/record/4634002
RT-Seq pipeline This paper https://zenodo.org/record/4634128
RT-Sim This paper https://zenodo.org/record/4634128