Skip to main content
. 2021 Nov 3;10:e70436. doi: 10.7554/eLife.70436

Key resources table.

Reagent type (species) or resource Designation Source or reference Identifiers Additional information
Strain, strain background (M. brevicollis) M. brevicollis ATCC PRA-258 PMID:18276888
Genetic reagent, (M. brevicollis) M. brevicollis STING­ This study STING­knockout strain; cell line maintained by A. Woznica
Transfected construct (M. brevicollis) pEFL5’-pac-P2A-STING-mTFP-3'act This study Construct to express M, brevicollis STING fused to mTFP; can be obtained from A. Woznica
Transfected construct (M. brevicollis) pEFL5’-pac-P2A-mCherry-Atg8-–3'act This study Construct to express mCherry fused to M. brevicollis Atg8; can be obtained from A. Woznica
Strain, strain background (Flavobacterium) Flavobacterium sp. This study Isolated from MX1 (ATCC PRA-258) culture; can be obtained from A. Woznica
Strain, strain background (Pseudomonas aeruginosa) PAO1 ATCC 15692 PMID:13961373
Strain, strain background (P. aeruginosa, transgenic strain) PAO1-GFP ATCC 15692GFP PMID:9361441
Antibody anti-choano STING (rabbit polyclonal) This study Generated by Pacific Immunology; dilution (1:200) for IF, (1:2000) dilution for WB; can be obtained from A. Woznica
Antibody Anti-mCherry 16D7 (rat monoclonal) Invitrogen Cat# M11217 (1:2000) dilution for WB
Antibody Anti-human Tubulin E7 (Mouse monoclonal) Developmental Studies Hybridoma Bank Cat# AB_2315513 (1:200) dilution for IF
Antibody Alpha-human tubulin (Mouse monoclonal) Sigma Aldrich Cat # T64074 (1:7000) dilution for WB
Chemical compound, drug 2’3’ cGAMP Cayman Chemical Cat# 19,887
Chemical compound, drug 3’3’ cGAMP Cayman chemical Cat# 17,966
Sequence-based reagent STING556 gRNA This study Guide RNA TTTCGGGATTCAGATGTGGG
Sequence-based reagent STING locus PCR primers This study PCR primers F: 5’ ATG ATG GTT AAT CTC TCT GAT CTT TCA CAT C 3’ R: 5’ TTA TGG CAT CGC ATA CTG GTC C 3’
Commercial assay or kit SG Cell Line 4D-NucleofectorTM X Kit S Lonza, Cat# V4XC-3032