Table 7.
Primer and cycling information for genes of interest and the respective housekeeping genes (*). The forward primer is denoted with (+) while the reverse primer is denoted with (−).
| Gene Symbol & ID | Gene Name | Primer Sequence | Tm (°C) | PCR Efficiency | Cycling Parameters |
|---|---|---|---|---|---|
|
Comt
(1312) |
Catechol-O-Methyltransferase | (+)attcacacctttctgaccaagc (−)ggggacagctctaggtgtagg |
58.0 | 93.60 | 1 cycle 95 °C 3 min; 40 cycles 95 °C 15 s 40 cycles Tm 30 s +Melt Curve |
|
Drd2
(1813) |
Dopamine Receptor D2 | (+)gcaatgtatcccttctcacagc (−)aggccaggaatagaaaagg |
55.0 | 94.65 | |
|
GR
(2908) |
Glucocorticoid Receptor | (+)tgtatgtgttatctggccatcc (−)tcccatagttttaggcatttgg |
54.0 | 102.63 | |
|
Sert
(6532) |
Serotonin Transporter | (+)ttttcaaagggattggttatgc (−)ttgtcctcggagaagtaattgg |
52.0 | 109.48 | |
|
CycA *
(5478) |
Cyclophilin A | (+)agcactggggagaaaggatt (−)agccactcagtcttggcagt |
58.0 | 102.20 | |
|
Ywhaz *
(7534) |
Tyrosine 3-monooxygenase/tryptophan, 5-monooxygenase activation protein, zeta | (+)ttgagcagaagacggaaggt (−)gaagcattggggatcaagaa |
56.1 | 105.34 |