Figure - PMC

Skip to main content

An official website of the United States government

Here's how you know

Here's how you know

Official websites use .gov
A .gov website belongs to an official government organization in the United States.

Secure .gov websites use HTTPS
A lock ( ) or https:// means you've safely connected to the .gov website. Share sensitive information only on official, secure websites.

View full-text article in PMC

. 2021 Nov 16;2(4):100965. doi: 10.1016/j.xpro.2021.100965

Search in PMC
Search in PubMed
View in NLM Catalog
Add to search

© 2021 The Author(s)

This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/).

PMC Copyright notice

Indel pattern analysis by Sanger sequencing and ICE analysis

(A) Cas9 and gRNA (DMD-in55-g3-gRNA: gactttatagatatctccca tgg) complex was electroporated into Ff-XT28s05 iPSCs by using 4D-nucleofector and P4 primary cell buffer. Sequencing results of the control sample (non-transfection) and experiment sample (transfected) were shown in upper panel. In the experiment sample, a mixture of spectrum can be observed after the Cas9 cleavage site.

(B) Analysis result by ICE software. Indel percentage of the above Sanger sequencing data analyzed by ICE was 92 %, and knockout-score (exclude in-frame indels) was 83 %.