REAGENT or RESOURCE | SOURCE | IDENTIFIER |
---|---|---|
Antibodies | ||
Chicken Polyclonal anti-GFP | Abcam | Cat# ab13970; RRID: AB_300798 |
Rat Monoclonal anti-mCherry | Thermo Fisher | Cat# M11217; RRID: AB_2536611 |
Goat Polyclonal anti-βgal | Bio-Rad | Cat# 4600–1409; RRID: AB_2307350 |
Mouse monoclonal anti-CALBINDIN-D-28K | Sigma | Cat# C9848; RRID: AB_476894 |
Rabbit Polyclonal anti-OTX2 | Proteintech | Cat# 13497–1-AP; RRID: AB_2157176 |
Goat Polyclonal anti-Aldh1a1 | R&D Systems | Cat# AF5869; RRID: AB_2044597 |
Rabbit Polyclonal anti-Sox6 | Sigma | Cat# HPA001923; RRID: AB_1080065) |
Guinea pig Polyclonal anti-Lmx1a | Gift from Yongchao C. Ma | N/A |
Rabbit Polyclonal anti-Lmx1a | Millipore | Cat# AB10533; RRID: AB_10805970 |
Rabbit Polyclonal anti-CALBINDIN-D-28K | Millipore | Cat# AB1778; RRID: AB_2068336 |
Mouse Monoclonal anti-ALDH1A1 | Sigma | Cat# SAB5300519 |
Rat Polyclonal anti-DAT | Santa Cruz Biotech | Cat# sc-32258; RRID: AB_627400 |
Mouse Monoclonal anti-RFP | Abcam | Cat# ab125244; RRID: AB_10973556 |
Sheep Polyclonal anti-TH | Pel-Freez | Cat# P60101–0; RRID: AB_461070 |
Chemicals, peptides, and recombinant proteins | ||
Tamoxifen | Sigma | T5648 |
Experimental models: cell lines | ||
PRX-B6 (C57BL/6N) (mouse ES cells) | The Jackson Laboratory | 012448; RRID: IMSR_JAX:012448 |
Experimental models: mouse strains | ||
Sox6-FSF-Cre | Poulin et al. 2018 | N/A |
Sox6-Cre | This paper | N/A |
Sox6-CreERT2 | This paper | N/A |
Th-2A-Flpo | Poulin et al. 2018 | N/A |
Mouse: Tg(EIIa-cre)C5379Lmgd | The Jackson Laboratory | 003724; RRID: IMSR_JAX:003724 |
Mouse: Slc17a6tm2(cre)Lowl | The Jackson Laboratory | 016963; RRID: IMSR_JAX:016963 |
NSF | (Poulin et al., 2020b) | N/A |
B6;129S6-Gt(ROSA)26Sortm8(CAG-mCherry,-EGFP) Dym/J | The Jackson Laboratory | 029486; RRID: IMSR_JAX:029486 |
RC-Fela | A gift from S. Dymecki (Jensen et al. 2008) | N/A |
Mouse: B6.Cg-Gt(ROSA)26Sortm65.2(CAG-tdTomato) Hze/J | The Jackson Laboratory | 032864; RRID: IMSR_JAX:032864 |
Mouse: B6;129S6-Gt(ROSA)26Sortm9(CAG-tdTomato) Hze/J | The Jackson Laboratory | 007905; RRID: IMSR_JAX:007905 |
Mouse: B6;129-Tg(CAG-dre)1Afst/Mmucd | MMRRC | 032246-UCD; RRID: MMRRC_032246-UCD |
Oligonucleotides | ||
Primers for Cre strains Cre-F: GCAGAACCTGAAGATGTTCGC | This paper | N/A |
Primers for Cre strain Cre-R: ACACCAGAGACGGAAATCCATC | This paper | N/A |
Primers for NSF F: CACCAAGACCAAGACCCTGT | This paper | N/A |
Primers for NSF R: CCTTCAGCAGCTGGTACTCC | This paper | N/A |
Primers for RC-Fela, RC-Frepe, RC-Ai9, RC-Ai65F -F: TGCAATACCTTTCTGGGAGTTC | This paper | N/A |
Primers for RC-Fela, RC-Frepe, RC-Ai9, RC-Ai65F -R: AGCGGGAGAAATGGATATGAAG | This paper | N/A |
Primers for RC-Fela, RC-Frepe, RC-Ai9, RC-Ai65F -R: TACCGTAAGTTATGTAACGCGG | This paper | N/A |
Primers for Th-2A-Flpo F- TAAGACCCTGCTGATGGTTGG | This paper | N/A |
Primers for Th-2A-Flpo R- CATAGGGCATTCCTGTGGTTTG | This paper | N/A |
Primers for Th-2A-Flpo R- GCTTCACTGAGTCTCTGGCATC | This paper | N/A |
Recombinant DNA | ||
AAV5-hSyn-CreOn/FlpOn-EYFP | UNC | # AV8357 |
AAV8EF1α-CreOff/FlpOn-mCherry | gift from K. Deisseroth | #2466 |
AAV5-EF1α-DIO-mCherry | UNC | #AV4311B |
AAVdj-hSyn-CreOff/FlpOn-eYFP | gift from K. Deisseroth | #987 |
AAV8-EF1α-CreOn/FlpOn-GCaMP6f | gift from K. Deisseroth | #2383 |
AAV8-EF1α-CreOff/FlpOn-GCaMP6f | gift from K. Deisseroth | #2385 |
Deposited data | ||
RNaseq of GFP and mCherry cells of Sox6-FSF-Cre, Th-2A-Flpo, RC- Frepe SNc | This Paper | GEO: GSE185480 |
Software and algorithms | ||
VS-ASW-S6 | Olympus | https://www.olympus-lifescience.com/en/microscopes/virtual/vs120/ |
cellSens | Olympus | https://www.olympus-lifescience.com/en/software/cellsens/ |
Zen 2.3 and 3.3 | Zeiss | https://www.zeiss.com/microscopy/us/products/microscope-software/zen.html |
MATLAB | MathWorks | https://www.mathworks.com/products/matlab.html |
RStudio | RStudio | https://www.rstudio.com/ |
FastQC | Babraham Bioinformatics | https://www.bioinformatics.babraham.ac.uk/projects/fastqc/ |
STAR | Dobin et al., 2013 | https://github.com/alexdobin/STAR |
DESeq2 | Bioconductor |
https://bioconductor.org/packages/release/bioc/html/DESeq2.html https://doi.org/10.18129/B9.bioc.DESeq2. |
cutadapt | cutadapt |
https://cutadapt.readthedocs.io/en/stable/ DOI: 10.14806 |
pheatmap | CRAN | https://cran.r-project.org/web/packages/pheatmap/index.html |
GSEA | UCSD | https://www.gsea-msigdb.org/gsea/index.jsp |
ImageJ | NIH | https://imagej.nih.gov/ij/ |