TABLE 2.
Sequences and positions of oligonucleotides used for 16S rRNA, ftsZ, and gltA gene amplifications
| Oligonucleotide name | Oligonucleotide sequencea | Target organism | Target gene | Nucleotide position (direction)b | Reference or source |
|---|---|---|---|---|---|
| 16SF | AGAGTTTGATCCTGG(CT)TCAG | Eubacteria | 16S rRNA | 10 (→) | 4 |
| 16SR | CTTTACGCCCA(AG)TAA(AT)TCCG | Eubacteria | 16S rRNA | 521 (←) | 4 |
| Bh ftsZ 965.p | GTATTCGCGAAGAAGTGGATGC | Bartonella spp. | ftsZ | 965 (→) | This study |
| Bh ftsZ 1393.n | GCGAACTACGGCTTACTTGC | B. henselae | ftsZ | 1393 (←) | This study |
| Bh ftsZ 1247.p | CGGTTGGAGAGCAGTTTCGTC | B. henselae | ftsZ | 1247 (→) | This study |
| Bh ftsZ 1754.n | CGACGTGGAACATAAACAGA | Bartonella spp. | ftsZ | 1754 (←) | This study |
| BHCS212.p | GTTATCCTATTGACCAA | Bartonella spp. | gltA | 212 (→) | 11 |
| BHCS613.n | TATTCTTCACAAGGAAC | Bartonella spp. | gltA | 613 (←) | 11 |
| BHCS510.p | AACTCTTGCCGCTATGG | Bartonella spp. | gltA | 510 (→) | 11 |
| BHCS897.n | CCAAAACCCATAAGGCG | Bartonella spp. | gltA | 897 (←) | 11 |
a
Bases in parentheses are mixed at one position.
b
Arrows indicate direction of primers (→, forward; ←, reverse).