Skip to main content
PMC home page
Plants logoLink to Plants
. 2021 Nov 12;10(11):2449. doi: 10.3390/plants10112449

Trichoderma hamatum Increases Productivity, Glucosinolate Content and Antioxidant Potential of Different Leafy Brassica Vegetables

Pablo Velasco 1, Víctor Manuel Rodríguez 1, Pilar Soengas 1, Jorge Poveda 2,*
Editors: Xiumin Fu, Yaping Chen
PMCID: PMC8619120  PMID: 34834812

Abstract

Brassica crops include important vegetables known as “superfoods” due to the content of phytochemicals of great interest to human health, such as glucosinolates (GSLs) and antioxidant compounds. On the other hand, Trichoderma is a genus of filamentous fungi that includes several species described as biostimulants and/or biological control agents in agriculture. In a previous work, an endophytic strain of Trichoderma hamatum was isolated from kale roots (Brassica oleracea var. acephala), describing its ability to induce systemic resistance in its host plant. In the present work, some of the main leafy Brassica crops (kale, cabbage, leaf rape and turnip greens) have been root-inoculated with T. hamatum, having the aim to verify the possible capacity of the fungus as a biostimulant in productivity as well as the foliar content of GSLs and its antioxidant potential, in order to improve these “superfoods”. The results reported, for the first time, an increase in the productivity of kale (55%), cabbage (36%) and turnip greens (46%) by T. hamatum root inoculation. Furthermore, fungal inoculation reported a significant increase in the content of total GSLs in cabbage and turnip greens, mainly of the GSLs sinigrin and gluconapin, respectively, along with an increase in their antioxidant capacity. Therefore, T. hamatum could be a good agricultural biostimulant in leafy Brassica crops, increasing the content of GSLs and antioxidant potential of great food and health interest.

Keywords: Trichoderma, cabbage, turnip greens, phenols, aliphatic glucosinolates

1. Introduction

Brassica genus, belonging to the Brassicaceae family (also known as Cruciferae), includes several crops with a high economic interest, cultivated for their edible roots, leaves, stems, buds, flowers, mustard and oilseeds [1]. The principal vegetable species belonging to the Brassica genus are Brassica napus (i.e., rapeseed and leaf rape), Brassica oleracea (i.e., broccoli, cabbage, cauliflower, kale, Brussels sprouts, etc.), Brassica rapa (i.e., turnip, Chinese cabbage and pak choi), Brassica juncea and Brassica carinata (mustards) [2].

Crops belonging to the Brassica genus are among the 10 most economically important vegetable crops in global agriculture and markets [2]. They are mainly cultivated in temperate regions of the northern hemisphere, such as areas of Europe, the Mediterranean area, Southwestern and Central Asia, China and Japan, and North America [2]. In 2019, the Food and Agriculture Organization of the United Nations (FAO) reported a global production of Brassica crops close to 170 million tons, being 27 million tons of ‘cauliflowers and broccoli’ in more than 1.4 million ha, 70 million tons of ‘rapeseed’ in more than 34 million ha, and about 70 million tons of ‘cabbages and other Brassica crops’ from almost 2.5 million ha in more than 150 countries [3]. Some of the main leafy Brassica crops include kale (B. oleracea var. acephala), cabbage (B. oleracea var. capitata), leaf rape (B. napus var. napus), and turnip tops and greens (B. rapa var. rapa) [4], which are the crops used in the present work.

Nowadays, consumers are demanding products (leaves, flower primordia, roots, oils, etc.) rich in nutrients for optimal health benefits. In this respect, the popularity of Brassica products is increasing because of their nutritional value and anticancer, antioxidant and anti-inflammatory properties [5]. Nutritionally, these vegetables are low-fat, have a high vitamin (C and E) content and contain minerals (P, S, Cl, Ca, Fe, Sr, K, Cr, Mn, Se and Zn) and fiber [5]. In addition, they contain important phytochemicals that are beneficial for human health, such as glucosinolates, anthocyanins, flavonoids, terpenes, S-methyl cysteine sulfoxide, coumarins and other small compounds [5].

Glucosinolates (GSLs) are a group of secondary plant metabolites found mainly in the order Brassicales and in the Brassicaceae family [6]. These phytochemicals are sulfur compounds derived from amino acids [7], whose main biological activity in plants is to act as defense against pathogens and pests [8,9]. Inside the cells, GSLs are chemically stable, but upon cell disruption due to tissue damage, GSLs are exposed to the activity of myrosinase and associated proteins, resulting in the so-called GHPs (glucosinolate hydrolysis products) [7].

Brassica vegetables contain about 50 different GSLs, although some species can present 15 different GSLs, with three to four of them being predominant (sinigrin, glucoraphanin, gluconapin and glucobrassicin) [10]. The highest concentration of GSLs is found in siliques and seeds, followed by leaves (approximately 1% of dry weight) [10]. Most of the studies carried out to date on GSLs in food have focused on Brassica vegetables, due to their importance in the human diet and their possible effects on disease prevention [10]. Among the effects that the consumption of GSLs has on human health, they stand out for their antimicrobial, antioxidant, anti-inflammatory, cholinesterase inhibitory, cytotoxic/anti-cancer, controlling blood sugar levels, antiglycation, suppression of mutagenicity, antifibrotic, antispasmodic, bone formation and parasiticidal activities [11].

In addition, Brassica vegetables have a higher antioxidant potential than other vegetable crops, mainly due to a higher content of phenolic compounds [12]. The antioxidant potential of Brassica vegetables adds another characteristic of interest for its use as “super food”, providing bioactive compounds that reduce oxidative stress and prevent the appearance of cancer, cardiovascular or neurological diseases [12,13].

In order to increase the productivity of Brassica crops and improve its GSL content and antioxidant capacity, different strategies can be considered, including symbiosis with endophytic fungi. Trichoderma is a genus of filamentous fungi that inhabit the rhizosphere and can behave as endophyte by colonizing the roots, without penetrating even the vascular bundles [14]. Trichoderma includes several species widely studied and used as beneficial microorganisms in agriculture, primarily as biological control agents, due to different mechanisms of action, such as mycoparasitism, antibiosis, space and nutrient competition, modulation of plant local and systemic resistance, mediated tolerance to abiotic stresses and plant growth promotion [15]. The ability of Trichoderma to promote plant growth and productivity in crops is a consequence of the production of different secondary metabolites (harzianic acid, 6-pentyl-a-pyrone) and phytohormones (auxins, cytokinins), fully known mechanisms in different endophytic fungi [16]. The ability to promote plant growth and yield has been previously described for Trichoderma in tomato or vineyard crops [17,18].

Root inoculation of Brassica crops with Trichoderma has reported interesting results in the last years. In rapeseed (B. napus), inoculation with T. harzianum supposes an increase in productivity of about 50% [19], which is also reported with the inoculation of T. parareesei under drought and salinity conditions at about 160% and 700%, respectively [20]. Similarly, a plant growth promotion and/or yield increment has been observed in butter cabbage (B. oleracea var. acephala) inoculated with T. asperelloides and T. virens [21]; in flowering Chinese cabbage (B. campestris ssp. chinensis var. utilis) inoculated with T. harzianum, T. asperellum, T. hamatum and T. atroviride [22]; and in pak choi (B. chinensis) inoculated with T. atroviride and T. citrinoviride [23]. Furthermore, the inoculation of Brassica crops roots with Trichoderma can lead to a reduction in the incidence of diseases by acting as a biological control agent, as has been reported in Chinese cabbage (Brassica rapa subsp. pekinensis) inoculated with T. harzianum against Plasmodiaphora brassicae (clubroot disease) [24], or in kale (B. oleracea var. acephala) inoculated with T. hamatum against Xanthomonas campestris (black rot) [25].

By colonizing the roots, Trichoderma is capable of modulating plant physiology, causing changes in the foliar metabolome. The colonization of maize roots by T. virens produces very significant metabolomic changes in the root and aerial part of the plant [26], changes that facilitate the response to different stresses, as has been observed in tomato under drought stress inoculated with T. harzianum [27]. Changes in the foliar metabolome have been studied with respect to defense-related secondary metabolites in Arabidopsis thaliana-T. gamsii system [28] and T. harzianum, T. virens and T. asperellum-olive system [29], although it also refers to metabolites of industrial interest, as in industrial hemp-T. harzianum system and the production of cannabidiol [30].

As far as we know, there are no studies conducted on the use of T. hamatum to promote plant growth and to increase the GSLs content and antioxidant content in Brassica crops. Therefore, the main objective of this work is to use T. hamatum, isolated from kale roots, as biostimulant, in order to obtain more productive Brassica crops and with better nutraceutical characteristics. To achieve this, Trichoderma-root colonization, fresh weight of the aerial plant part, GSL content and its antioxidant activity have been quantified. Therefore, the hypothesis of the work is that T. hamatum can improve the cultivation of leafy Brassica crops by colonizing their roots, promoting growth of the aerial part and the content of GSLs and antioxidant capacity.

2. Results

2.1. Effect on the Foliar Yield of Brassica Crops

In leafy Brassica crops, the foliar mass refers directly to the yield, as it is the consumed part. Root inoculation with T. hamatum represented a significant increase in the fresh and dry biomass of the aerial part of kale, cabbage and turnip greens. Specifically, an increase in the weight of the fresh product of 55% in kale, 36% in cabbage and 46% in turnip greens was reported. However, no significant differences were observed in leaf rape biomass by fungal inoculation (Figure 1).

Figure 1.

Figure 1

Open in a new tab

Mean of fresh (a) and dry weight (b) of kale (Boa), cabbage (Boc), leafy rape (Bn) and leafy turnip (Br) grown in greenhouse conditions. Plants without inoculation and inoculated with T. hamatum (+Th) were collected at 8 weeks old and measured their fresh and dry weight of the aerial part. Data are the mean of 10 plants for each crop and condition with the corresponding standard deviation. Student’s t-test was performed between uninoculated and Trichoderma-inoculated plants. Asterisks denote significant differences at p ≤ 0.05 (*).

2.2. GSLs Profiles in Brassica Leaves

In both kale and leaf rape, no significant differences were reported in foliar GSL profiles between plants inoculated with T. hamatum and without inoculation (Figure 2a,c). In cabbage leaves, root inoculation with T. hamatum caused a significant increase in the total content of GSLs (10.74 nmol/mg), both aliphatic GSLs (8.83 nmol/mg) and indole GSLs (2.11 nmol/mg). Within the aliphatic GSLs, a significant increase in glucoiberin (2.01 nmol/mg) and sinigrin (6.49 nmol/mg) was found, while glucobrassicin (1.88 nmol/mg) was the indole GSL stimulated by T. hamatum (Figure 2b). In turnip greens, a significant increase in the total content of GSLs (60.84 nmol/mg) and aliphatic GSLs (58.54 nmol/mg) was reported by root inoculation with T. hamatum. Specifically, this is due to the significant increase in the content of the aliphatic GSL gluconapin (53.23 nmol/mg) (Figure 2d).

Figure 2.

Figure 2

Open in a new tab

GSLs contents in leaves from kale (Boa) (a), cabbage (Boc) (b), leafy rape (Bn) (c) and leafy turnip (Br) (d) without inoculation and inoculated with T. hamatum (+Th). GIB: glucoiberin, SIN: sinigrin, PRO: progoitrin, ALY: glucoalyssin, GNA: gluconapin, GBS: glucobrassicin, MeOH: metoxy-glucobrassicin, NeoGBS: neoglucobrassicin, GNT: gluconasturtiin. Data are the mean of 10 plants for each crop and condition with the corresponding standard deviation. Student’s t-test was performed between uninoculated and Trichoderma-inoculated plants for each GSL. Asterisks denote significant differences at p ≤ 0.05 (*).

2.3. Antioxidant Potential in Brassica Leaves

In kale, leaf rape and turnip greens leaves, no significant differences were quantified in antioxidant activity (ABTS oxidation) between uninoculated and root-inoculated plants with T. hamatum. However, significant differences were reported in the case of cabbage plants (14.36 µmol/g) (Figure 3a). Regarding the phenolic content (measured by Folin reagent), no significant differences were quantified between the kale and leaf rape plants without inoculation and inoculated with the fungus. On the contrary, in cabbage (1.13 µmol gallic acid/g) and turnip greens (1.38 µmol gallic acid/g) plant roots inoculated with T. hamatum, significantly higher levels of phenolic compounds were observed in their leaves (Figure 3b).

Figure 3.

Figure 3

Open in a new tab

Antioxidant activity (ABTS+) (a) and phenolic content (Folin reagent) (b) in leaves from kale (Boa), cabbage (Boc), leafy rape (Bn) and leafy turnip (Br) without inoculation and inoculated with T. hamatum (+Th). Data are the mean of 10 plants for each crop and condition with the corresponding standard deviation. Student’s t-test was performed. Asterisks denote significant differences at p ≤ 0.05 (*).

2.4. Trichoderma-Roots Colonization

Regarding the root colonization of Brassica plants by Trichoderma, no significant differences were quantified in the levels of root colonization between the different leafy crops (Figure 4). However, on average, the roots of B. oleracea var. capitata and B. rapa show a higher rate of colonization by T. hamatum (0.051 and 0.037, respectively) than the roots of B. oleracea var. acephala and B. napus (0.027 and 0.029, respectively).

Figure 4.

Figure 4

Open in a new tab

Measurements of Brassica-root colonization by Trichoderma by qPCR in kale (Boa), cabbage (Boc), leafy rape (Bn) and leafy turnip (Br). Values are the proportion of fungal DNA vs. plant DNA means of three root pools (three plants each one) with the corresponding standard deviations. One-way analysis of variance (ANOVA) was performed, followed by the Tukey’s test. No significant differences (p < 0.05) were found.

3. Discussion

In a previous study, it was reported that T. hamatum did not produce a significant increase in the biomass produced by kale plants [25]. However, it involved the activation of a systemic resistance that caused plants to be significantly less affected by the phytopathogenic bacterium X. campestris [25]. In our study, we have reported how root inoculation with T. hamatum supposes a significant increase in the foliar biomass produced by kale, cabbage and turnip greens. Possibly, the differences observed with respect to the previous study carried out with kale are due to the method of Trichoderma-inoculation. In the first study, Trichoderma was applied to the roots as mycelium grown on beet pulp, while in this work, the inoculation was carried out as spores. In relation to the results obtained, increases in the biomass of the aerial part in plants root-inoculated with T. hamatum have been reported in lettuce [31,32,33], Vigna mungo [34] and cacao seedlings [35]. As far as Brassica crops are concerned, only kale plants had previously been inoculated with T. hamatum [25]. However, in a recent study where Chinese flower cabbage plants were root-inoculated with a formulation of different Trichoderma species, including T. hamatum together with T. harzianum, T. asperellum and T. atroviride, a significant increase in plant growth and the yield was reported compared to uninoculated plants [22].

The increase in plant growth and GSL content in Brassica crops simultaneously by Trichoderma inoculations has not been reported previously. Despite this, it has been observed how the irrigation application of T. harzianum spores in B. rapa subsp. sylvestris cv. esculenta supposed a higher production of foliar biomass, although it did not report significant changes in the amount of total GSLs accumulated [36]. Regarding the analysis of individual GSLs, it has been determined as the application of T. atroviride in rapeseed [37] and of T. harzianum and T. atroviride in B. rapa subsp. sylvestris cv. esculenta [38] and did not suppose a significant increase in the foliar accumulation of any of them either.

GSLs are widely studied and used compounds in agriculture for their antifungal capacity against a large number of phytopathogenic fungi [9]. Regarding the filamentous fungus Trichoderma, it has been described that it requires the action of specific proteins that act on the hydrolysis of GSLs in order to colonize the roots of crucifers [39]. Furthermore, it has been shown that indole GSLs are involved in reducing root colonization by Trichoderma in A. thaliana. Reporting as in the absence of indole GSLs, Trichoderma mostly colonizes the roots, which implies a greater systemic resistance and tolerance against abiotic stresses in A. thaliana [40].

In our study, the application of T. hamatum in cabbage and turnip greens supposed a significant increase in the content of total GSLs and antioxidant potential in its leaves. This is due to an increase in the content of aliphatic (glucoiberin and sinigrin) and indole GSLs (glucobrassicin) in cabbage and in aliphatic GSLs (gluconapin) in turnip greens. The increase in the content of secondary defense metabolites, such as GSLs and phenols, in both Brassica crops could be due to the activation of a systemic resistance by the root colonization of T. hamatum, previously described in cucumber [41], tomato [42], geranium [43] or A. thaliana [44].

The increase in these GSLs in cabbage and turnip greens represents an important result in the food sector, for the use of Brassica leafy crops as nutraceutical foods. Glucoiberin is one of the GSLs of greatest interest in the use of Brassica vegetables as anticancer foods [45]. This is due to the fact that the isothiocyanate derived from its hydrolysis (called iberin) is involved in the activity of Phase II enzymes, which are able to conjugate with activated carcinogens and turn them into inactive water-soluble compounds [45]. Sinigrin is present in all B. oleracea crops, such as broccoli, brussels sprouts and cabbage. Moreover, it is one of the GSLs with the most benefits for human health, since it has anti-cancer, antibacterial, antifungal, antioxidant, anti-inflammatory, and wound-healing properties [46]. Glucobrassicin is one of the most widely present GSLs in different Brassica vegetables, being the natural precursor of recognized anti-cancer and chemo preventive agents, such as indole-3-carbinol and 3,3′-diindolylmethane. These compounds have been widely investigated and have been shown to suppress the proliferation of various cancer cell lines, such as those of breast, colon, prostate and endometrium [47]. Finally, gluconapin is a GSL present in the majority form in leaves of B. rapa. Until now, few advantages of its inclusion in the diet have been described, but it is known that it is capable of reducing plasma triglyceride levels, acting as a preventive of postprandial hypertriglyceridemia [48].

Similarly, increasing the antioxidant potential of Brassica leaves is an important finding in their use as nutraceutical foods. The ingestion of antioxidants prevents intracellular oxidation, which has been associated with health promotion and the prevention of most degenerative diseases, such as atherosclerosis, cancer, diabetes, arthritis, an improved cardiovascular and neurological health, reduced cancer incidence, increased longevity and lowered overall mortality [49]. In the specific case of phenols, whose content increased in cabbage and turnip greens leaves root-inoculated with T. hamatum, they represent an important group of antioxidants to consider in the diet. It is important to note their beneficial effects in the prevention of cancer and cardiovascular, inflammatory and neurodegenerative diseases as well as to their contribution in lowering the risk of depression and cognitive decline during aging [50].

It has been previously described how the beneficial effects of Trichoderma on plants are modified according to their levels of fungal-root colonization [39,40]. However, our work reported important differences between the different Brassica crops used, without there being a significant difference between the levels of root colonization by T. hamatum.

4. Materials and Methods

4.1. Biological Material

As Brassica leafy crops, local populations from the MBG germplasm bank were used: MBG-00063 (B. napus), MBG-00163 (B. rapa), MBG-00462 (B. oleracea var. acephala) and MBG-00535 (B. oleracea var. capitata).

T. hamatum was isolated from roots of kale in a previous work with different local populations from Galicia (Northwestern Spain) [25], identified by the sequences ITS (MT641233) and Tub (OL389793). The fungus was routinely grown on potato dextrose agar (PDA, Sigma-Aldrich, Madrid, Spain) in the dark at 28 °C. Spores were harvested from 7-day-old PDA dishes, as previously described by [51].

4.2. Plant Growth and Trichoderma Inoculation

Brassica plants were individually grown from seeds in 5 L pots. The plants were kept under controlled greenhouse conditions until their aerial part was harvested in 8-week-old plants to record fresh and dry weight. The plants were watered one to two times per week, according to the observed needs, always with the same amount of water in all the plants. The plants were grown on a substrate consisting of peat moss (Profi-Substract, Gramoflor, Valencia, Spain) previously treated at 80 °C for 24 h. Exogenous fertilization was not used. Greenhouse conditions were 14 h photoperiod, controlled environmental temperature (12–30 °C) and relative humidity above 80%. A total of 10 plants (in 10 pots) were used for each condition and crop.

Root inoculation with Trichoderma was carried out as described by [39] for rapeseed (B. napus). In 4-week-old plants, the main root was inoculated with 1 mL of a conidial suspension containing 2 × 107 spore ml−1, determined using a hemocytometer.

4.3. GSLs Analysis

For GSLS and antioxidant potential analyses, the 4th leaf from the apex of 10 plants were collected in liquid nitrogen and stored at −80 °C until freeze-dried in a lyophilizer (GAMMA 2-16 LSC plus, Christ, Germany). Samples were mechanically milled to a fine powder in a grinder (Janke and Kunkel A10 mill, IKA-Labortechnik, Staufen, Germany) before metabolite extraction. The samples were always kept as 10 independent biological replicates (one per plant).

The analysis of the GSLs profile in the samples was carried out following the methodology described by [52], with some modifications. Twelve mg of freeze-dried Brassica leaves powder were mixed with 400 μL 70% (v/v) methanol preheated to 70 °C, 10 μL of PbAc (0.3 M) and 120 μL ultra-pure water preheated to 70 °C. Before, 20 μL of glucotropaeolin was added as an internal standard. The tubes were shaken in a Microplate incubator (Model OVAN Orbital Midi) at 250 rpm for one hour and centrifuged at 3700 rpm for 12 min. Subsequently, 400 µL of the glucosinolate extracts was pipetted on an ion-exchange column with Sephadex DEAE-A25. By adding of purified sulfatase (E.C. 3.1.6.1, type H-1 from Helix pomatia) (Sigma) solution, desulfation was carried out. Finally, the desulphated GSLs were diluted in 200 µL of ultra-pure water and 200 µL of 70% methanol, keeping frozen for further analyzes.

Using this method, only desulfoglucosinolates were extracted, so a matrix effect is not expected. This fact was further confirmed by spiking with commercial standards. Besides, the percentage of glucosinolate recovery using this method is around 99%.

The chromatographic analyses were carried out on an Ultra-High-Performance Liquid Chromatograph (UHPLC Nexera LC-30AD; Shimadzu, Kyoto, Japan) equipped with a Nexera SIL-30AC injector and one SPDM20A UV/VIS photodiode array detector. The UHPLC column was a X Select ®HSS T3 (2.5 µm particle size, 2.1 × 100 mm i.d.) from Waters (Waters Corporation, Milford, MA, USA) protected with a Van Guard pre-column. The oven temperature was set at 35 °C. GSLs were quantified at 229 nm and were separated by using the following method in aqueous acetonitrile, with a flow of 0.5 mL min−1: 1.5 min at 100% H2O, an 11 min gradient from 5% to 25% (v/v) acetonitrile, 1.5 min at 25% (v/v) acetonitrile, a minute gradient from 25% to 0% (v/v) acetonitrile and a final 3 min at 100% H2O. Specific GSLs were identified by comparing retention times and UV spectra with standards. GSLs standards were purchase from Phytoplan (Diehm & Neuberger GmbH, Heidelberg, Germany). Calibration equations were made with at least five data points. Specific GSLs were identified by comparing retention times and UV spectra with standards. GSLs standards were purchased from Phytoplan (Diehm & Neuberger GmbH, Heidelberg, Germany). Calibration equations were made with at least five data points for the glucosinolates glucoiberin (y = 99397x; R2 = 0.950), sinigrin (y = 484871x; R2 = 0.994), gluconapin (y = 352910x; R2 = 0.999), glucobrassicanapin (y = 357893x; R2 = 0.997), glucoerucin (y = 276.122x; R2 = 0.999), glucobrassicin (y = 869483x; R2 = 0.988), gluconasturtiin (y = 342954x; R2 = 0.997), progoitrin (y = 398645x; R2 = 0.980).

4.4. Antioxidant Potential Assays

The antioxidant potential of the foliar tissues was analyzed following the methodology described by [53]. In order to obtain leaf extracts, 1 mL of 80% aqueous methanol was added to 10 mg of the leaf sample and left it in dark for 24 h. Subsequently, the extracts were centrifuged afterward (3700 rpm, 5 min). The antioxidant activity and the content of phenolic compounds were measured in the methanolic extracts using ABTS+ assay and Folin reagent, respectively. ABTS+ was generated by the oxidation of 7 mM ABTS with 2.45 mM K2S2O8 at room temperature for 16 h. The stock solution of ABTS+ was diluted in water to reach an absorbance between 0.8 and 1.0 at 734 nm. Then, 20 μL of each methanolic extract was mixed to 250 mL of the ABTS+ solution, and the absorbance was recorded after 30 min of incubation under dark conditions. The results were standardized to Trolox equivalents per gram of dry weight. To quantify total phenolic content, 50 μL of each extract was mixed with 50 μL of 0.5 M Folin reagent. The reaction was neutralized after 5 min with 200 μL of 20% Na2CO3. After 2 h of incubation in dark conditions, the absorbance of the reaction was measured at 760 nm.

4.5. Quantification of Trichoderma-Root Colonization

The quantification of fungal DNA in Brassica roots was performed by qPCR as previously described by [40], with some modifications. DNA was extracted from roots of Trichoderma inoculated plants, using the Phire Plant Direct PCR Kit (Termo Fisher Scientifc, Waltham, MA, USA). A mix was prepared in a 10 μL volume using 5 μL of Brilliant SYBR Green QPCR Master Mix (Roche, Penzberg, Germany), 10 ng of DNA, the forward and reverse primers at a final concentration of 100 nM and nuclease-free PCR-grade water to adjust the final volume. Different endogenous genes of each Brassica crop and actin in Trichoderma were used, of which the corresponding first pairs are indicated in Table 1. Amplifications were performed in an ABI PRISM 7000 Sequence Detection System (Applied Biosystems, Foster City, CA, USA) programmed for 40 cycles under the following conditions: denaturation, 95 °C for 15 s; annealing, 60 °C for 1 min; extension, 72 °C for 1 min. Each PCR was performed in triplicate by using the DNA extracted from 3 root pools of 3 plants each, one for each treatment. Cycle threshold values served to calculate the amount of fungal DNA using standard curves. Values of fungus DNA were referred to the amount of kale DNA in every corresponding sample.

Table 1.

Primers used in the quantification of Trichoderma-root colonization.

Code Sequence (5′-3′) Use References
Act-T-F ATGGTATGGGTCAGAAGGA Endogenous Trichoderma gene [40]
Act-T-R ATGTCAACACGAGCAATGG
GADPH-Bo-F TCAGTTGTTGACCTCACGGTT Endogenous B. oleracea gene [54]
GADPH-Bo-R CTGTCACCAACGAAGTCAGT
Tub-Bn-F TTCAAAGAACATGATGTGTGCC Endogenous B. napus gene [54]
Tub-Bn-R CGTTTATCATCTGTTCGTCCAC
Act-Br-F TGTGCCAATCTACGAGGGTTT Endogenous B. rapa gene [55]
Act-Br-R TTTCCCGCTCGGCTGTTGT
Open in a new tab

From each crop, the whole roots of 9 plants were collected, grouping them into pools of 3 plant-roots. Roots were collected in 8-week-old plants, 4 weeks post-Trichoderma-roots inoculation. All root material was washed with water until there was no remaining substrate, immediately frozen with liquid nitrogen, and pulverized with a mortar.

4.6. Statistical Analysis

The statistical analysis of the data was carried out with the Statistix 8.0 software. To perform the data normality confirmation analysis, the Shapiro−Wilk test was performed. Student’s t-test was used for comparison of means of groups of 10 plants at p < 0.05; significant differences are denoted using an asterisk. The group means were represented in columns in the graphs, representing the variance in the form of error bars. In quantification of Trichoderma-root colonization, one-way ANOVA using Tukey’s multiple range test at p < 0.05 was used for pairwise comparisons; different letters indicate significant differences (p < 0.05).

5. Conclusions

As conclusions, the root inoculation of T. hamatum supposes an increase in the productivity of several leafy Brassica crops, being the first report for the fungus in these crops. Furthermore, the fungal application supposes an increase in productivity, GSLs and antioxidant potential (simultaneously) in cabbage (B. oleracea var. capitata) and turnip greens (B. rapa var. rapa), representing the first report that relates the Trichoderma-inoculation with the increase of GSLs and antioxidant potential in Brassica crops. Therefore, T. hamatum could be a good agricultural biostimulant in leafy Brassica crops, increasing the content of GSLs and antioxidant potential of great food and health interest.

Author Contributions

J.P. and P.V. conceived and designed the experiments. P.V. performed in planta experiments. P.V. and V.M.R. performed GSLs analysis. P.S. performed antioxidant potential analysis. J.P. analyzed the data and wrote the manuscript. P.V., V.M.R. and P.S. contributed to the manuscript correction and critical reading. All authors have read and agreed to the published version of the manuscript.

Funding

This research was financially supported by projects RTI2018-096591-B-I00 34 (MCIU/AEI/FEDER, UE) and IN607A 2021/03 (Xunta de Galicia, Spain).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

Footnotes

Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Poveda J., Francisco M., Cartea M.E., Velasco P. Development of transgenic Brassica crops against biotic stresses caused by pathogens and arthropod pests. Plants. 2020;9:1664. doi: 10.3390/plants9121664. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Francisco M., Tortosa M., Martínez-Ballesta M.D.C., Velasco P., García-Viguera C., Moreno D.A. Nutritional and phytochemical value of Brassica crops from the agri-food perspective. Ann. Appl. Biol. 2017;170:273–285. doi: 10.1111/aab.12318. [DOI] [Google Scholar]
  • 3.Food and Agriculture Organization of the United Nations (FAO) FAOSTAT Database. Top Exports of “Cabbages and Other Brassicas”, “Cauliflowers and Broccoli” and “Rapeseed”. 2019. [(accessed on 8 May 2021)]. Available online: http://www.fao.org/faostat/en/#data/QC.
  • 4.Cartea M.E., Lema M., Francisco M., Velasco P. Basic information on vegetable Brassica crops. In: Sadowski J., Kole C., editors. Genetics, Genomics and Breeding of Vegetable Brassicas. Science Publishers, Inc.; Enfield, NH, USA: 2011. pp. 1–33. [Google Scholar]
  • 5.Sanlier N., Guler S.M. The benefits of Brassica vegetables on human health. J. Hum. Health Res. 2018;1:1–13. [Google Scholar]
  • 6.Sikorska-Zimny K., Beneduce L. The glucosinolates and their bioactive derivatives in Brassica: A review on classification, biosynthesis and content in plant tissues, fate during and after processing, effect on the human organism and interaction with the gut microbiota. Crit. Rev. Food Sci. Nutr. 2020;61:2544–2571. doi: 10.1080/10408398.2020.1780193. [DOI] [PubMed] [Google Scholar]
  • 7.Bell L. The biosynthesis of glucosinolates: Insights, inconsistencies, and unknowns. Annu. Plant Rev. 2018;2:969–1000. doi: 10.1002/9781119312994.apr0708. [DOI] [Google Scholar]
  • 8.Hopkins R.J., van Dam N.M., van Loon J.J. Role of glucosinolates in insect-plant relationships and multitrophic interactions. Annu. Rev. Entomol. 2009;54:57–83. doi: 10.1146/annurev.ento.54.110807.090623. [DOI] [PubMed] [Google Scholar]
  • 9.Poveda J., Eugui D., Velasco P. Natural control of plant pathogens through glucosinolates: An effective strategy against fungi and oomycetes. Phytochem. Rev. 2020;19:1045–1059. doi: 10.1007/s11101-020-09699-0. [DOI] [Google Scholar]
  • 10.Wu X., Huang H., Childs H., Wu Y., Yu L., Pehrsson P.R. Glucosinolates in Brassica vegetables: Characterization and factors that influence distribution, content, and intake. Annu. Rev. Food. Sci. 2021;12:485–511. doi: 10.1146/annurev-food-070620-025744. [DOI] [PubMed] [Google Scholar]
  • 11.Maina S., Misinzo G., Bakari G., Kim H.Y. Human, animal and plant health benefits of glucosinolates and strategies for enhanced bioactivity: A systematic review. Molecules. 2020;25:3682. doi: 10.3390/molecules25163682. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Soengas P., Sotelo T., Velasco P., Cartea M.E. Antioxidants properties of Brassica vegetables. In: Teixeira da Silva J., editor. Functional Plant Science and Biotechnology. Volume 5. Global Science Books; Kagawa-ken, Japan: 2011. pp. 43–55. [Google Scholar]
  • 13.Soengas P., Cartea M.E., Francisco M., Sotelo T., Velasco P. New insights into antioxidant activity of Brassica crops. Food Chem. 2012;134:725–733. doi: 10.1016/j.foodchem.2012.02.169. [DOI] [PubMed] [Google Scholar]
  • 14.Alonso-Ramírez A., Poveda J., Martín I., Hermosa R., Monte E., Nicolás C. Salicylic acid prevents Trichoderma harzianum from entering the vascular system of roots. Mol. Plant Pathol. 2014;15:823–831. doi: 10.1111/mpp.12141. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Sachdev S., Singh R.P. Ecological and Practical Applications for Sustainable Agriculture. Springer; Singapore: 2020. Trichoderma: A multifaceted fungus for sustainable agriculture; pp. 261–304. [Google Scholar]
  • 16.Poveda J., Eugui D., Abril-Urías P., Velasco P. Endophytic fungi as direct plant growth promoters for sustainable agricultural production. Symbiosis. 2021;85:1–19. doi: 10.1007/s13199-021-00789-x. [DOI] [Google Scholar]
  • 17.Macías-Rodríguez L., Guzmán-Gómez A., García-Juárez P., Contreras-Cornejo H.A. Trichoderma atroviride promotes tomato development and alters the root exudation of carbohydrates, which stimulates fungal growth and the biocontrol of the phytopathogen Phytophthora cinnamomi in a tripartite interaction system. FEMS Microbiol. Ecol. 2018;94:fiy137. doi: 10.1093/femsec/fiy137. [DOI] [PubMed] [Google Scholar]
  • 18.Pascale A., Vinale F., Manganiello G., Nigro M., Lanzuise S., Ruocco M., Marra R., Lombardi N., Woo S.L., Lorito M. Trichoderma and its secondary metabolites improve yield and quality of grapes. Crop Prot. 2017;92:176–181. doi: 10.1016/j.cropro.2016.11.010. [DOI] [Google Scholar]
  • 19.Poveda J., Hermosa R., Monte E., Nicolás C. Trichoderma harzianum favours the access of arbuscular mycorrhizal fungi to non-host Brassicaceae roots and increases plant productivity. Sci. Rep. 2019;9:11650. doi: 10.1038/s41598-019-48269-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Poveda J. Trichoderma parareesei favors the tolerance of rapeseed (Brassica napus L.) to salinity and drought due to a chorismate mutase. Agronomy. 2020;10:118. doi: 10.3390/agronomy10010118. [DOI] [Google Scholar]
  • 21.Steffen G.P.K., Steffen R.B., Maldaner J., de Morais R.M., Handte V.G., de Freitas de Morais A., Costa A.F.P., Saldanha C.W., Missio E.L., Quevedo A.C. Increasing productivity of cabbage by two species of Trichoderma fungi. Int. J. Environ. Sci. 2020;78:797–803. doi: 10.1080/00207233.2020.1845551. [DOI] [Google Scholar]
  • 22.Ji S., Liu Z., Liu B., Wang Y., Wang J. The effect of Trichoderma biofertilizer on the quality of flowering Chinese cabbage and the soil environment. Sci. Hortic. 2020;262:109069. doi: 10.1016/j.scienta.2019.109069. [DOI] [Google Scholar]
  • 23.Chen D., Hou Q., Jia L., Sun K. Combined use of two Trichoderma strains to promote growth of pakchoi (Brassica chinensis L.) Agronomy. 2021;11:726. doi: 10.3390/agronomy11040726. [DOI] [Google Scholar]
  • 24.Li J., Philp J., Li J., Wei Y., Li H., Yang K., Ryder M., Toh R., Zhou Y., Denton M.D., et al. Trichoderma harzianum inoculation reduces the incidence of clubroot disease in chinese cabbage by regulating the rhizosphere microbial community. Microorganisms. 2020;8:1325. doi: 10.3390/microorganisms8091325. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Poveda J., Zabalgogeazcoa I., Soengas P., Rodríguez V.M., Cartea M.E., Abilleira R., Velasco P. Brassica oleracea var. acephala (kale) improvement by biological activity of root endophytic fungi. Sci. Rep. 2020;10:20224. doi: 10.1038/s41598-020-77215-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Schweiger R., Padilla-Arizmendi F., Nogueira-López G., Rostas M.G., Lawry R., Brown C.M., Hampton J., Steyaert J.M., Müller C., Mendoza-Mendoza A. Insights into metabolic changes caused by the Trichoderma virens–maize root interaction. Mol. Plant-Microbe Interact. 2021;34:524–537. doi: 10.1094/MPMI-04-20-0081-R. [DOI] [PubMed] [Google Scholar]
  • 27.Mona S.A., Hashem A., Abd_Allah E.F., Alqarawi A.A., Soliman D.W.K., Wirth S., Egamberdieva D. Increased resistance of drought by Trichoderma harzianum fungal treatment correlates with increased secondary metabolites and proline content. J. Integr. Agric. 2017;16:1751–1757. doi: 10.1016/S2095-3119(17)61695-2. [DOI] [Google Scholar]
  • 28.Zhou D., Huang X.F., Guo J., dos-Santos M.L., Vivanco J.M. Trichoderma gamsii affected herbivore feeding behaviour on Arabidopsis thaliana by modifying the leaf metabolome and phytohormones. Microb. Biotechnol. 2018;11:1195–1206. doi: 10.1111/1751-7915.13310. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Marra R., Coppola M., Pironti A., Grasso F., Lombardi N., D’Errico G., Sicari A., Censi S.B., Woo S.L., Rao R., et al. The application of Trichoderma strains or metabolites alters the olive leaf metabolome and the expression of defense-related genes. J. Fungi. 2020;6:369. doi: 10.3390/jof6040369. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Kakabouki I., Tataridas A., Mavroeidis A., Kousta A., Karydogianni S., Zisi C., Kouneli V., Konstantinou A., Folina A., Konstantas A., et al. Effect of colonization of Trichoderma harzianum on growth development and CBD content of hemp (Cannabis sativa L.) Microorganisms. 2021;9:518. doi: 10.3390/microorganisms9030518. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Ryder L.S., Harris B.D., Soanes D.M., Kershaw M.J., Talbot N.J., Thornton C.R. Saprotrophic competitiveness and biocontrol fitness of a genetically modified strain of the plant-growth-promoting fungus Trichoderma hamatum GD12. Microbiology. 2012;158:84–97. doi: 10.1099/mic.0.051854-0. [DOI] [PubMed] [Google Scholar]
  • 32.Studholme D.J., Harris B., Le Cocq K., Winsbury R., Perera V., Ryder L., Ward J.L., Beale M.H., Thornton C.R., Grant M. Investigating the beneficial traits of Trichoderma hamatum GD12 for sustainable agriculture-insights from genomics. Front. Plant Sci. 2013;4:258. doi: 10.3389/fpls.2013.00258. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Shaw S., Le Cocq K., Paszkiewicz K., Moore K., Winsbury R., de Torres Zabala M., Studholme D.J., Salmon D., Thornton C.R., Grant M.R. Transcriptional reprogramming underpins enhanced plant growth promotion by the biocontrol fungus Trichoderma hamatum GD12 during antagonistic interactions with Sclerotinia sclerotiorum in soil. Mol. Plant Pathol. 2016;17:1425–1441. doi: 10.1111/mpp.12429. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Badar R., Qureshi S.A. Comparative effect of Trichoderma hamatum and host-specific Rhizobium species on growth of Vigna mungo. Appl. Pharm. Sci. 2012;2:128. doi: 10.7324/JAPS.2012.2409. [DOI] [Google Scholar]
  • 35.Bae H., Sicher R.C., Kim M.S., Kim S.H., Strem M.D., Melnick R.L., Bailey B.A. The beneficial endophyte Trichoderma hamatum isolate DIS 219b promotes growth and delays the onset of the drought response in Theobroma cacao. J. Exp. Bot. 2009;60:3279–3295. doi: 10.1093/jxb/erp165. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Caporale A.G., Vitaglione P., Troise A.D., Pigna M., Ruocco M. Influence of three different soil types on the interaction of two strains of Trichoderma harzianum with Brassica rapa subsp. sylvestris cv. esculenta, under soil mineral fertilization. Geoderma. 2019;350:11–18. doi: 10.1016/j.geoderma.2019.05.003. [DOI] [Google Scholar]
  • 37.Maag D., Kandula D.R., Müller C., Mendoza-Mendoza A., Wratten S.D., Stewart A., Rostás M. Trichoderma atroviride LU132 promotes plant growth but not induced systemic resistance to Plutella xylostella in oilseed rape. BioControl. 2014;59:241–252. doi: 10.1007/s10526-013-9554-7. [DOI] [Google Scholar]
  • 38.Gallo M., Esposito G., Ferracane R., Vinale F., Naviglio D. Beneficial effects of Trichoderma genus microbes on qualitative parameters of Brassica rapa L. subsp. sylvestris L. Janch. var. esculenta Hort. Eur. Food Res. Technol. 2013;236:1063–1071. doi: 10.1007/s00217-013-1971-4. [DOI] [Google Scholar]
  • 39.Poveda J., Hermosa R., Monte E., Nicolás C. The Trichoderma harzianum Kelch protein ThKEL1 plays a key role in root colonization and the induction of systemic defense in Brassicaceae plants. Front. Plant Sci. 2019;10:1478. doi: 10.3389/fpls.2019.01478. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Poveda J. Glucosinolates profile of Arabidopsis thaliana modified root colonization of Trichoderma species. Biol. Control. 2021;155:104522. doi: 10.1016/j.biocontrol.2020.104522. [DOI] [Google Scholar]
  • 41.Khan J., Ooka J.J., Miller S.A., Madden L.V., Hoitink H.A.J. Systemic resistance induced by Trichoderma hamatum 382 in cucumber against Phytophthora crown rot and leaf blight. Plant Dis. 2004;88:280–286. doi: 10.1094/PDIS.2004.88.3.280. [DOI] [PubMed] [Google Scholar]
  • 42.Alfano G., Ivey M.L.L., Cakir C., Bos J.I.B., Miller S.A., Madden L., Kamoun S., Hoitink H.A.J. Systemic modulation of gene expression in tomato by Trichoderma hamatum 382. Phytopathology. 2007;97:429–437. doi: 10.1094/PHYTO-97-4-0429. [DOI] [PubMed] [Google Scholar]
  • 43.Olson H.A., Benson D.M. Induced systemic resistance and the role of binucleate Rhizoctonia and Trichoderma hamatum 382 in biocontrol of Botrytis blight in geranium. Biol. Control. 2007;42:233–241. doi: 10.1016/j.biocontrol.2007.05.009. [DOI] [Google Scholar]
  • 44.Mathys J., De Cremer K., Timmermans P., Van Kerckhove S., Lievens B., Vanhaecke M., Cammue B.P.A., De Coninck B. Genome-wide characterization of ISR induced in Arabidopsis thaliana by Trichoderma hamatum T382 against Botrytis cinerea infection. Front. Plant Sci. 2012;3:108. doi: 10.3389/fpls.2012.00108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Cartea M.E., Velasco P. Glucosinolates in Brassica foods: Bioavailability in food and significance for human health. Phytochem. Rev. 2008;7:213–229. doi: 10.1007/s11101-007-9072-2. [DOI] [Google Scholar]
  • 46.Mazumder A., Dwivedi A., Du Plessis J. Sinigrin and its therapeutic benefits. Molecules. 2016;21:416. doi: 10.3390/molecules21040416. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Galletti S., Bagatta M., Branca F., Argento S., De Nicola G.R., Cianchetta S., Iori R., Ninfali P. Isatis canescens is a rich source of glucobrassicin and other health-promoting compounds. J. Sci. Food Agric. 2015;95:158–164. doi: 10.1002/jsfa.6697. [DOI] [PubMed] [Google Scholar]
  • 48.Washida K., Miyata M., Koyama T., Yazawa K., Nomoto K. Suppressive effect of Yamato-mana (Brassica rapa L. Oleifera Group) constituent 3-butenyl glucosinolate (gluconapin) on postprandial hypertriglyceridemia in mice. Biosci. Biotechnol. Biochem. 2010;74:1286–1289. doi: 10.1271/bbb.100018. [DOI] [PubMed] [Google Scholar]
  • 49.Poljsak B., Kovač V., Milisav I. Antioxidants, food processing and health. Antioxidants. 2021;10:433. doi: 10.3390/antiox10030433. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Issaoui M., Delgado A.M., Caruso G., Micali M., Barbera M., Atrous H., Ouslati A., Chammem N. Phenols, flavors, and the mediterranean diet. J. AOAC Int. 2020;103:915–924. doi: 10.1093/jaocint/qsz018. [DOI] [PubMed] [Google Scholar]
  • 51.Poveda J. Biological control of Fusarium oxysporum f. sp. ciceri and Ascochyta rabiei infecting protected geographical indication Fuentesaúco-Chickpea by Trichoderma species. Eur. J. Plant Pathol. 2021;160:825–840. doi: 10.1007/s10658-021-02286-9. [DOI] [Google Scholar]
  • 52.Poveda J., Velasco P., de Haro A., Johansen T.J., McAlvay A.C., Möllers C., Mølmann J.A.B., Ordiales E., Rodríguez V.M. Agronomic and metabolomic side-effects of a divergent selection for glucobrassicinindol-3-ylmethylGSL content. Metabolites. 2021;11:384. doi: 10.3390/metabo11060384. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Soengas P., Rodríguez V.M., Velasco P., Cartea M.E. Effect of temperature stress on antioxidant defenses in Brassica oleracea. ACS Omega. 2018;3:5237–5243. doi: 10.1021/acsomega.8b00242. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Sotelo T., Velasco P., Soengas P., Rodríguez V.M., Cartea M.E. Modification of leaf glucosinolate contents in Brassica oleracea by divergent selection and effect on expression of genes controlling glucosinolate pathway. Front. Plant Sci. 2016;7:1012. doi: 10.3389/fpls.2016.01012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Ma L., Wu J., Qi W., Coulter J.A., Fang Y., Li X., Liu L., Jin J., Niu Z., Yue J., et al. Screening and verification of reference genes for analysis of gene expression in winter rapeseed (Brassica rapa L.) under abiotic stress. PLoS ONE. 2020;15:e0236577. doi: 10.1371/journal.pone.0236577. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Not applicable.

Articles from Plants are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES