TABLE 1.
Oligonucleotide probes used for FISH
Probe | Target species | Probe sequence (5′-3′) | Target site | Reference |
---|---|---|---|---|
EUB338 | Bacteria | GCTGCCTCCCGTAGGAGT | 16S rRNA | 1 |
PseaerA | P. aeruginosa | GGTAACCGTCCCCCTTGC | 16S rRNA | Trebesius et al., submitted |
PseaerB | P. aeruginosa | TCTCGGCCTTGAAACCCC | 23S rRNA | Trebesius et al., submitted |
Stemal | S. maltophilia | GTCGTCCAGTATCCACTGC | 16S rRNA | Present study |
Burcep | B. cepacia | CTGTGCGCCGGTTCTCTT | 16S rRNA | Present study |
Burkho | Burkholderia spp. | ACCCTCTGTTCCGACCAT | 16S rRNA | Present study |
Haeinf | H. influenzae | CCGCACTTTCATCTTCCG | 16S rRNA | Present study |
Staaur | S. aureus | GAAGCAAGCTTCTCGTCCG | 16S rRNA | Trebesius et al., submitted |
Caal | C. albicans | GCCAAGGCTTATACTCGCT | 18S rRNA | 9 |
Strpyo | Streptococcus pyogenes | CTAACATGCGTTAGTCTCTC | 16S rRNA | Trebesius et al., submitted |
BET42a | Beta subclass of Proteobacteria | GCCTTCCCACTTCGTTT | 16S rRNAa | 10 |
Unlabeled probe BET42a was added to hybridization buffer to reduce nonspecific binding of labeled oligonucleotide probes.