Table 1.

Details of primer and probe sequences used for the DMAS-RT-PCR assay.

Oligonucleotide function	Oligonucleotide name	Sequence*	Length & Tm⁎⁎
Forward primer for Reaction ‘A’. Reaction ‘A’ detects non-Delta SARS-CoV-2	Non-Delta_DMAS_F	5′ GGTTGGTGGTAATTATAATTCCCT	24 nt 59.7 °C
Reverse primer for Reaction ‘A’. Reaction ‘A’ detects non-Delta SARS-CoV-2	Non-Delta_DMAS_R	5′ CCTTCAACACCATTACAACGTG	22 nt 60.2 °C
Forward primer for Reaction ‘B’. Reaction ‘B’ detects the Delta variant of SARS-CoV-2	Delta_DMAS_F	5′ GGTTGGTGGTAATTATAATTCCCG	24 nt 60.5 °C
Reverse primer for Reaction ‘B’. Reaction ‘B’ detects the Delta variant of SARS-CoV-2	Delta_DMAS_R	5′ CCTTCAACACCATTACAACGTT	22 nt 59.9 °C
Common probe for both Reaction ‘A’ and Reaction ‘B’. Probe located on antisense strand	Common_A& B_Prb	5′ FAM-TCTCTCAAAAGGTTTGAGATTAGACTTCC-BHQ‡	29 nt 64.9 °C

*Underlined nucleotides represent the second mismatch deliberately inserted to increase specificity. ‘C’ was chosen in each case as the least stable artificial mismatch on the basis of reported mismatch stability ranking [11]. The terminal 3′ nucleotide being targeted is shown highlighted in bold italic.

^⁎⁎Tm calculated for the matched target using IDT OligoAnalyzer tool with qPCR parameter set and assuming primer concentration of 400 nM and probe concentration of 250 nM. Tm calculated with the deliberate internal mismatched base omitted.

^‡FAM = 6-Carboxyfluorescein BHQ = Black Hole Quencher.