KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| chicken anti-GFP | Abcam | Cat# ab13970; RRID:AB_300798 |
| rabbit anti-RFP | MBL International | Cat# PM005; RRID:AB_591279 |
| rabbit anti-GFP | ICL Lab | Cat# RGFP-45A |
| rabbit anti-Lhx1 | gift from Dr. Masanori Taira, Chou University | N/A |
| mouse anti-E-cadherin | BD Transduction Laboratories | Cat# 610182; RRID:AB_397581 |
| anti-rabbit IgG Alexa 488 | Invitrogen | Cat# A-11008; RRID:AB_143165 |
| anti-rabbit IgG Alexa 555 | Invitrogen | Cat# A-21428; RRID:AB_2535849 |
| anti-rabbit IgG Alexa 647 | Invitrogen | Cat# A-21244; RRID:AB_2535812 |
| anti-mouse IgG Alexa 488 | Invitrogen | Cat# A-11001; RRID:AB_2534069 |
| anti-mouse IgG Alexa 555 | Invitrogen | Cat# A-21422; RRID:AB_2535844 |
| anti-mouse IgG Alexa 647 | Invitrogen | Cat# A-21235; RRID:AB_2535804 |
| anti-mouse IgG Alexa 488 | Jackson ImmunoResearch | Cat# 715-545-150; RRID:AB_2340846 |
| anti-chicken IgY Alexa 488 | Invitrogen | Cat# A-11039; RRID:AB_2534096 |
| rabbit anti-Daam1 | Proteintech | Cat# 14876-1-AP; RRID:AB_2089444 |
| rabbit anti-Daam1 | a gift from Dr. Raymond Habas’s lab, Temple University | N/A |
| rabbit anti-GAPDH | Santa Cruz | Cat# sc-25778; RRID:AB_10167668 |
| anti-rabbit IgG (H + L)-HRP | BioRad | Cat# 1706515; RRID:AB_11125142 |
| anti-mouse IgG (H + L)-HRP | BioRad | Cat# 1706516; RRID:AB_11125547 |
| Chemicals, peptides, and recombinant proteins | ||
| FITC-conjugated lectin from Erythrina cristagalli | Vector labs | Cat# FL-1141; RRID:AB_2336437 |
| Phalloidin-Alexa 568 | Invitrogen | Cat# A12380 |
| diamidino-2-phenylindole (DAPI) | Tdermo Scientific | Cat# 62247 |
| Dulbecco’s Modified Eagle’s Medium (DMEM) | Sigma | Cat# A5955 |
| fetal bovine serum (FBS) | Sigma | Cat# F0926 |
| Antibiotic-antimycotic solution | Sigma | Cat# A5955 |
| 2x Laemmli Sample Buffer | BioRad | Cat# 610737 |
| Dithiothreitol | Fisher BioReagents | Cat# BP172-25 |
| 16% Formaldehyde (w/v), Methanol-free | Thermo Scientific | Cat# 28908 |
| Fibronectin | Roche | Cat# 10 838 039 001 |
| Ethyl 3-aminobenzoate methanesulfonate | Sigma | Cat# E10521 |
| Critical commercial assays | ||
| SP6 mMessage mMachine transcription kit | TdermoFisher | Cat# AM1340M |
| KPL Detector Block Kit | Sera Care | Cat# 5920-0004, 71-83-00 |
| SuperSignal West Pico PLUS Chemiluminescent Substrate | Thermo Fisher | Cat# 34580 |
| Experimental models: Cell lines | ||
| Madin-Darby Canine Kidney (MDCK) II | American Type Culture Collection (ATCC) | Cat# ATCC® CRL-2936 |
| HEK293T cells | a gift from Dr. Andrew Gladden’s lab, North Carolina University | N/A |
| Experimental models: Organisms/strains | ||
| Xenopus laevis adult male frogs | Nasco | Cat# LM00713M |
| Xenopus laevis adult female frogs | Nasco | Cat# LM00531MX |
| Oligonucleotides | ||
| Daam1 morpholino-5′GCCGCAGGTCTGTCAGTTGCTTCTA 3′ | GeneTools, LLC | Corkins et al., 2018; Habas et al., 2001; Miller et al., 2011 |
| Control/Standard morpholino-5′CCTCTTACCTCAGTTACAATTTATA 3′ | GeneTools, LLC | Corkins et al., 2018; Miller et al., 2011 |
| pLKO.1 lentiviral shDaam1 construct-TTTCAGGAGATAGTATTGTGC | GE-Dharmacon | Clone ID: TRCN0000122999 |
| pLKO.1 lentiviral shDaam1 construct-AAACAGGTCTTTAGCTTCTGC | GE-Dharmacon | Clone ID: TRCN0000123000 |
| Recombinant DNA | ||
| pCS2-GFP-Daam1 | a gift from Dr. Raymond Habas’s lab, Temple University | Liu et al., 2008 |
| pCS2-GFP-Daam1 (Ile698Ala) | a gift from Dr. Bruce Goode’s lab, Brandeis University | Lu et al., 2007 |
| pCS2-membrane-tagged-RFP | a gift from Dr. Raymond Keller’s lab, University of Virginia | Davidson et al., 2006 |
| pCS2- mCherry -Daam1 | Dr. Rachel Miller’s lab, McGovern Medical School | Corkins et al., 2019 |
| pCS2-mCherry-Daam1 (Ile698Ala) | Dr. Rachel Miller’s lab, McGovern Medical School | Corkins et al., 2019 |
| pCS2-membrane-tagged-EGFP | a gift from Dr. John Wallingford’ lab, The University of Texas at Austin | Shindo and Wallingford, 2014 |
| pCS2-mCherry-Utrophin | a gift from Dr. William Bement’s lab, University of Wisconsin-Madison | Burkel et al., 2007 |
| virus packaging plasmids psPAX2 and pMD2.G | a gift from Dr. Andrew Gladden’s lab, University of North Carolina | Williams et al., 2017 |
| Software and algorithms | ||
| Slidebook 6.0 | 3i-Intelligent Imaging Innovations Software | https://www.intelligent-imaging.com/slidebook |
| SigmaPlot | Systat Software | https://systatsoftware.com/products/sigmaplot/ |
| Prism 8.0 | GraphPad Software | https://www.graphpad.com/scientific-software/prism/ |
| ImageJ (Fiji plugin) | Open-source program | https://imagej.nih.gov/ij/ |
| Adobe Photoshop CC | Adobe Inc. Software | https://www.adobe.com/products/photoshop.html |
| Other | ||
| Tweezer - Dumont no.5 | Fisher | Cat# NC9404145 |
| Glass-bottom imaging chambers | Tdermo | Cat# A7816 |