|
| Antibodies |
|
|
|
| Chicken Polyclonal Anti-GFP |
Abcam |
Cat# ab13970, RRID: AB_300798 |
| Rabbit Polyclonal Anti-Glutamate Receptor NMDAR2A (GluN2A) |
Sigma-Aldrich |
Cat# M264, RRID: AB_260485 |
| Rabbit Polyclonal Anti-Glutamate Receptor NMDAR2B (GluN2B) |
Sigma-Aldrich |
Cat# M265, RRID: AB_260487 |
| Rabbit Polyclonal Anti-Phospho-Ezrin (Thr567)/Radixin(Thr564)/Moesin (Thr558) (p-ERM) |
Cell Signaling Technology |
Cat# 3141, RRID: AB_330232 |
| Rabbit Polyclonal Anti-Ezrin/Radixin/Moesin (ERM) |
Cell Signaling Technology |
Cat# 3142, RRID: AB_2100313 |
| Rabbit Polyclonal Anti-GABA(A) α5 Receptor |
Synaptic Systems |
Cat# 224503, RRID: AB_2619944 |
| Rabbit Polyclonal Anti-GABA(A) α1 Receptor |
Millipore |
Cat# 06–868, RRID: AB_310272 |
|
| Chemicals, peptides, and recombinant proteins |
|
|
|
| NeuroMag reagent |
Oz Biosciences |
Cat# NM51000 |
| CalPho Mammalian Transfection Kit |
Takara |
Cat# 631312 |
| Bicuculline |
Abcam |
Cat# ab120110 |
| D-APV |
Abcam |
Cat# ab120003 |
| DNQX |
Alomone labs |
Cat# D-131 |
| Tetrodotoxin (TTX) |
Alomone Labs |
Cat# T-550 |
| Picrotoxin |
Sigma-Aldrich |
Cat# P1675 |
| NVP-AAM077 Tetrasodium Hydrate |
Sigma-Aldrich |
Cat# 5.04528 |
| Ifenprodil (+)-tartrate salt |
Sigma-Aldrich |
Cat# I2892 |
| Kainic acid |
Abcam |
Cat# ab120100 |
| 4,5,6,7-tetrahydroisoxazolo(5,4-c) pyridin-3-ol (THIP) |
Santa Cruz |
Cat# SC204342 |
| Q5 Site-Directed Mutagenesis Kit |
NEB |
Cat# E0554S |
| EZ-Link Sulfo-NHS-SS-Biotin |
Thermo Fisher Scientific |
Cat# 21331 |
| Pierce Glutathione Agarose |
Thermo Fisher Scientific |
Cat# 16101 |
|
| Experimental models: cell lines |
|
|
|
| Primary cultures of hippocampal neurons |
This paper |
N/A |
| HEK293T |
ATCC |
Cat# CRL-1126 |
|
| Experimental models: organisms/strains |
|
|
|
| C57BL/6N mice |
Charles River |
Cat# 027 |
|
| Oligonucleotides |
|
|
|
| sgRNA targeting sequence: mouse GluN2A: CGACGTGACAGAACGCGAAC |
This paper |
N/A |
| sgRNA targeting sequence: mouse GluN2B: GTCTGACCGGAAGATCCAGG |
This paper |
N/A |
|
| Recombinant DNA |
|
|
|
| pRK5-GFP-GluN2A |
Dr. Katherine Roche (NIH) |
N/A |
| pRK5-GFP-GluN2B |
Dr. Katherine Roche (NIH) |
N/A |
| pSpCas9(BB)-2A-Puro (PX459) V2.0 |
Addgene |
Cat# 62988 |
| pSpCas9(BB)-2A-GFP (PX458) |
Addgene |
Cat# 48138 |
| GluN2A sgRNA |
This paper |
N/A |
| GluN2B sgRNA |
This paper |
N/A |
| sgRNA-resistant GluN2A |
This paper |
N/A |
| sgRNA-resistant GluN2B |
This paper |
N/A |
|
| Software and algorithms |
|
|
|
| ImageJ |
NIH |
https://imagej.nih.gov/ij/
|
| GraphPad Prism 8.0 |
GraphPad |
https://www.graphpad.com
|
| Igor Pro |
Wavemetrics |
https://www.wavemetrics.com
|
