. 2021 Nov 12;10:e71443. doi: 10.7554/eLife.71443

Appendix 1—table 1. Plasmids and primers used for cloning.

Plasmid types	Plasmid name, cloning, and primer information
Promoter plasmids (Multi-Site Gateway slot 1):	dg701[slot1 Entry ima-3p]attB4ima-3_F: ggggacaagtttgtacaaaaaagcaggcttacatatgagttcaaacagacaggcttattattB1ima-3_R: ggggaccactttgtacaagaaagctgggtcggatccctttccaaagttccatcctccgdg508[slot1 Entry ttx-1p]attB4_F: ggggacaactttgtatagaaaagttgatccatactcaggggaacagtgtattB1_R: ggggactgcttttttgtacaaacttgtgaagcaggaatatatgacaaatgaaatacgThe generation of dg68[slot1 Entry mec-3p(noATG)] and dg229[slot1 Entry QUASprom] was previously described in Schild and Glauser, 2015 and the generation of mg268[slot1 Entry cmk-1p] in Schild et al., 2014.
Coding sequence plasmids (Multi-Site Gateway slot 2):	dg703[slot2 Entry ima-3cds]attB1ima3cds_F: ggggacaagtttgtacaaaaaagcaggcttacatatgagttcaaacagacaggcttattattB2ima3cds_R: ggggaccactttgtacaagaaagctgggtcggatccctttccaaagttccatcctccgThe generation of dg240 [slot2 Entry QF_withATG] and dg245[mec-4p(2kb)::QS::SL2mCherry] was previously described in Schild and Glauser, 2015; the generation of dg286 [slot2 Entry (cmk-1cds_noSTOP)] was described in Hostettler et al., 2017; the generation of dg651 [slot2 Entry egl-13NLS::wrmScarlet] was described in Marques et al., 2019; the generation of dg718[slot2 Entry YC2.3] was described in Saro et al., 2020.dg215[pENTR slot2_calb28K] created by PCR amplification from [odr-3p::calbindin D28K] (gift from Chiou-Fen Chuang) followed by subcloning into pDON221 via BP recombination.dg217[pENTR slot2_rParv] created by PCR amplification from [odr-3p:: rParv] (gift from Chiou-Fen Chuang) followed by subcloning into pDON221 via BP recombination.dg219[pENTR slot2_rParv_mutant] created by PCR amplification from [odr-3p:: rParvCDEF/AV] (gift from Chiou-Fen Chuang) followed by subcloning into pDON221 via BP recombination.dg643[pENTR slot2 Ex13_CeBFP-reporter_V2] was created amplifying by PCR and subcloning into pDON221 by BP recombination a codon-optimized CeBFP version containing three artificial introns obtained via gene synthesis (Eurofins DNA).dg650[slot2 Entry egl-13NLS::wrmScarlet] was created adding to dg643 the egl-13NLS by PCR with the following primers:NLSRightHalf_CeBFP_F: aaacgcgaagaagcttgccaaggaagttgaaaatggatccatgtcagagcttattaaggNLSLeftHalf_CeBFP_R: cactcagttttgtcggattcgcttttcgtctacggctcatgttgctagcggtacctaag
Plasmids carrying cmk-1 coding sequence with small deletions and primers used to introduce these deletions:	dg168[slot2 Entry cmk-1(Δ315–323)]cmk-1_324F: tcctcaaatagcaatcgcctacagaaaccmk-1_314R: tgctgcggggctgcgttdg173[slot2 Entry cmk-1(Δ318–324)]cmk-1_325F: tcaaatagcaatcgcctacagaaacaagcmk-1_317R: ctggcggattgctgcggdg192[slot2 Entry cmk-1(Δ288–294)]CMK-1_287R: atcgtgtgtgtacgccgtatttcCMK-1_295F: catcttaagaagagtttggcaaaacgga
Plasmids with cmk-1 point mutations and primers used for site-directed mutagenesis:	dg588[slot2 Entry cmk-1(K71A/R74Q/R77S)]NLS^71-78_F: cagaagctctcacacaacaatattgttcaactattcgaNLS^71-78_R: cagaactgcaatctcgttttccagtgattcttcdg589[slot2 Entry cmk-1(W305S)]W305S_F: ccaaaaaggcttacaacgcagccW305S_R: agttccgttttgccaaactcttctdg590[slot2 Entry cmk-1(V292A/V294A)]NES^288-294_F: cgctcatcttaagaagagtttggcaaaacggaNES^288-294_R: gcggcagttccgtgaatatcgtgtgtgtacdg591[slot2 Entry cmk-1(L321A/L323A)]NES^314-323_F: gctcgtgcttcctcaaatagcaatcgcctacagaaNES^314-323_R: catttgaagctggcggattgctdg593[slot2 Entry cmk-1(K307Q)]NLS^297-308_F: caggcttacaacgcagccgcNLS^297-308_R: tttccagttccgttttgccaaactcttcdg612[slot2 Entry cmk-1(R303S/K307Q)]NLS^297-308_F: tccaactggaaacaggcttacaacgNLS^297-308_R: ttttgccaaactcttcttaagatgtacgdg658[slot2 Entry cmk-1(K71A/R74Q/R77S/V292A/V294A)]NLS^71-78_F/R with dg608 as templatedg663[slot2 Entry cmk-1(V292A/V294A/W305S)]W305S_F/R with dg608 as templatedg674[slot2 Entry cmk-1(K71A)]NLS^71-78_ K71A_F: aggaagctccgacacaacNLS^71-78_ K71A_R: cagaactgcaatctcgttttccagtgattcttcdg675[slot2 Entry cmk-1(R74Q)]NLS^71-78_ R74Q_F: cagaagctccgacacaacaatattgttcaactaNLS^71-78_ R74Q_R: cagaactttaatctcgttttccagtgattcttcdg676[slot2 Entry cmk-1(R77S)]NLS^71-78_ R77S_F: tcacacaacaatattgttcaactattcgaNLS^71-78_ R77S_R: gagcttcctcagaactttaatctcdg688[slot2 Entry cmk-1(I315A)]NES^314-323_315F: ctccgtctctcctcaaatagcaatcgcNES^314-323_315R: catttgaagctggcgggctgctgcgdg689[slot2 Entry cmk-1(I315A/L321A/L323A)]NES^314-323_315F/R with dg608 as template
3′ UTR and tagging plasmids (Multi-site Gateway slot 3):	mg277[slot3 Entry SL2::mCherry] was previously described in Schild et al., 2014.mg211[slot3 Entry unc-54 3’UTR] (aka pMH473) was a gift from Marc Hammarlund.dg397[slot3 Entry mNG::3xFLAG::unc-54 3’UTR] previously described in Hostettler et al., 2017.
Selection markers used for transgenesis:	dg9 [coel::RFP] (or unc-122p::RFP) was a gift from Piali Sengupta (Addgene plasmid # 8938).dg396 [coel::GFP] (or unc-122p::GFP) was a gift from Piali Sengupta (Addgene plasmid # 8937).
Expression plasmids used for transgenesis with a description of their creation:	dg405[mec-3p::cmk-1::mNG::3xFlag] was previously created through an LR recombination reaction between dg68, dg286, dg397 and PCFJ150 (Hostettler et al., 2017).dg425[cmk-1p::cmk-1(wt)::mNG::3xFlag::unc-54 3’UTR] was previously created through an LR recombination reaction between mg268, dg286, dg397, and pDEST-R4-P3 (Hostettler et al., 2017).dg515[mec-3p::cmk-1(Δ315–323)::mNG::3xFlag::unc-54 3’UTR] was created through an LR recombination reaction between dg68, dg168, dg397, and pDEST-R4-P3.dg520[mec-3p::cmk-1(Δ318–324)::mNG::3xFlag::unc-54 3’UTR] was created through an LR recombination reaction between dg68, dg173, dg397, and pDEST-R4-P3.dg524[mec-3p::cmk-1(Δ288–294)::mNG::3xFlag::unc-54 3’UTR] was created through an LR recombination reaction between dg68, dg192, dg397, and pDEST-R4-P3.dg605[mec-3p::cmk-1(K71A/R74Q/R77S)::mNG::3xFlag::unc-54 3’UTR] was created through an LR recombination reaction between dg68, dg588, dg397, and pDEST-R4-P3.dg606[mec-3p::cmk-1(W305S)::mNG::3xFlag::unc-54 3’UTR] was created through an LR recombination reaction between dg68, dg589, dg397, and pDEST-R4-P3.dg607[mec-3p::cmk-1(V292A/V294A)::mNG::3xFlag::unc-54 3’UTR] was created through an LR recombination reaction between dg68, dg590, dg397, and pDEST-R4-P3.dg608[mec-3p::cmk-1(L321A/L323A)::mNG::3xFlag::unc-54 3’UTR] was created through an LR recombination reaction between dg68, dg591, dg397, and pDEST-R4-P3.dg610[mec-3p::cmk-1(K307Q)::mNG::3xFlag::unc-54 3’UTR] was created through an LR recombination reaction between dg68, dg593, dg397, and pDEST-R4-P3.dg613[mec-3p::cmk-1(R303S/K307Q)::mNG::3xFlag::unc-54 3’UTR] was created through an LR recombination reaction between dg68, dg612, dg397, and pDEST-R4-P3.dg665[mec-3p::cmk-1(K71A/R74Q/R77S/V292A/V294A)::mNG::3xFlag::unc-54 3’UTR] was created through an LR recombination reaction between dg68, dg658, dg397, and pDEST-R4-P3.dg670[mec-3p::cmk-1(V292A/V294A/W305S)::mNG::3xFlag::unc-54 3’UTR] was created through an LR recombination reaction between dg68, dg663, dg397, and pDEST-R4-P3.dg677[mec-3p::cmk-1(K71A)::mNG::3xFlag::unc-54 3’UTR] was created through an LR recombination reaction between dg68, dg674, dg397, and pDEST-R4-P3.dg678[mec-3p::cmk-1(R74Q)::mNG::3xFlag::unc-54 3’UTR] was created through an LR recombination reaction between dg68, dg675, dg397, and pDEST-R4-P3.dg679[mec-3p::cmk-1(R77S)::mNG::3xFlag::unc-54 3’UTR] was created through an LR recombination reaction between dg68, dg676, dg397, and pDEST-R4-P3.dg694[mec-3p::cmk-1(I315A)::mNG::3xFlag::unc-54 3’UTR] was created through an LR recombination reaction between dg68, dg688, dg397, and pDEST-R4-P3.dg695[mec-3p::cmk-1(I315A/L321A/L323A)::mNG::3xFlag::unc-54 3’UTR] was created through an LR recombination reaction between dg68, dg689, dg397, and pDEST-R4-P3.dg705[ima-3p::egl-13NLS::wrmScarlet::unc-54 3’UTR] was created through an LR recombination reaction between dg701, dg651, mg211, and pDEST-R4-P3.dg876[QUAS::cmk-1(wt)::mNG::3xFlag::unc-54 3’UTR] was created through an LR recombination reaction between dg229, dg286, dg397, and pDEST-R4-P3.dg877[QUAS::cmk-1(K71A/R74Q/R77S)::mNG::3xFlag::unc-54 3’UTR] was created through an LR recombination reaction between dg229, dg588, dg397, and pDEST-R4-P3.dg878[QUAS::cmk-1(R77S)::mNG::3xFlag::unc-54 3’UTR] was created through an LR recombination reaction between dg229, dg286, dg676, and pDEST-R4-P3.dg879[QUAS::cmk-1(V292A/V294)::mNG::3xFlag::unc-54 3’UTR] was created through an LR recombination reaction between dg229, dg590, dg397, and pDEST-R4-P3.dg882[QUAS::cmk-1(W305S)::mNG::3xFlag::unc-54 3’UTR] was created through an LR recombination reaction between dg229, dg589, dg397, and pDEST-R4-P3.dg883[ttx-1p::QF::unc-54 3’UTR] was created through an LR recombination reaction between dg508, dg240, mg211, and pDEST-R4-P3.dg777[QUAS::YC2.3::unc-54 3’UTR] was created through an LR recombination reaction between dg229, dg718, mg211 , and pDEST-R4-P3.dg280[mec-3p::Calb28K::unc54UTR] was created through an LR recombination reaction between dg68, dg215, mg211, and pDEST-R4-P3dg282[mec-3p::rParv::unc-54UTR] was created through an LR recombination reaction between dg68, dg217, mg211, and pDEST-R4-P3.dg284[mec-3p::rParv_mutant::unc-54UTR] was created through an LR recombination reaction between dg68, dg219, mg211, and pDEST-R4-P3.dg373[QUAS::NeonGreen] was created through an LR recombination reaction between dg229 (pENTR_slot1_QUASprom) dg353, mg211, and pDEST-R4-P3.dg653[mec-3p::egl-13NLS::CeBFP::unc-54 3’UTR] was created through an LR recombination reaction between dg68, dg650, mg211, and pDEST-R4-P3.
Plasmids used for recombinant protein expression:	dg918[ima-3::His-6] was created by inserting ima-3 coding sequence using NdeI and BamHI restriction sites in pDK2832 (Gift from Dieter Kressler). The ima-3 coding sequence was obtained from a modified dg703 plasmid in which an internal BamHI site had been removed using the following primers:Ima-3Bamless_F: cgatccaaacttgcaatttgaagctgIma-3Bamless_R: gtgctggacaagcattgaacgdg922 [cmk-1(wt)::GST-TEV] was created by insertion of cmk-1 cds using NdeI and BamHI restriction sites in pDK2409 (Gift from Dieter Kressler).dg929[cmk-1(K71A/R74Q/R77S)::GST-TEV] was created by PCR site-directed mutagenesis from dg922.