. Author manuscript; available in PMC: 2022 Dec 2.

Published in final edited form as: Structure. 2021 Sep 11:S0969-2126(21)00261-6. doi: 10.1016/j.str.2021.07.011

KEY RESOURCES TABLE.

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Bacterial and Virus Strains
E. coli BL21 (DE3)	Agilent	F– ompT hsdSB (rB – mB – ) gal dcm (DE3)
E. coli XL-1 Blue competent cells	Agilent	recA1 endA1 gyrA96 thi-1 hsdR17 supE44 relA1 lac [F ´ proABlacI^qZ∆M15 Tn10 (Tet^r)]
Biological Samples
Chemicals, Peptides, and Recombinant Proteins
TAZ1 domain of M. musculus CREB-binding protein	This paper	N/A
H. sapiens Hypoxia inducible factor 1α C-terminal activation domain	This paper	N/A
H. sapiens CITED2 C-terminal activation domain	This paper	N/A
H. sapiens CITED2 C-terminal activation domain - H. sapiens Hypoxia inducible factor 1α C-terminal activation domain fusion peptide	This paper	N/A
H. sapiens CITED2 C-terminal activation domain - H. sapiens Hypoxia inducible factor 1α C-terminal activation domain fusion peptide L21A-mutant	This paper	N/A
H. sapiens CITED2 C-terminal activation domain - H. sapiens Hypoxia inducible factor 1α C-terminal activation domain fusion peptide L63A-mutant	This paper	N/A
Critical Commercial Assays
Deposited Data
Crystal structure of the CREB-binding protein TAZ1 domain in complex with a CITED2 C-terminal activation domain - Hypoxia inducible factor 1α C-terminal activation domain fusion peptide	This paper	PDB 7LVS
NMR solution structure of the CREB-binding protein TAZ1 domain in complex with a CITED2 C-terminal activation domain	De Guzman et al., 2004	PDB 1R8U
NMR solution structure of the CREB-binding protein TAZ1 domain in complex with a Hypoxia inducible factor 1α C-terminal activation domain	Dames et al., 2002	PDB 1L8C
NMR solution structure of TAZ1	De Guzman et al., 2005	PDB 1U2N
Backbone chemical shift assignments: CITED2 C-terminal activation domain - Hypoxia inducible factor 1α C-terminal activation domain fusion peptide	This paper	BMRB 50866
Backbone chemical shift assignments: CITED2 C-terminal activation domain - Hypoxia inducible factor 1α C-terminal activation domain fusion peptide in complex with the CREB-binding protein TAZ1 domain: TAZ1	This paper	BMRB 50865
Backbone chemical shift assignments: CITED2 C-terminal activation domain - Hypoxia inducible factor 1α C-terminal activation domain fusion peptide in complex with the CREB-binding protein TAZ1 domain: fusion peptide	This paper	BMRB 50865
Backbone chemical shift assignments: CITED2 C-terminal activation domain - Hypoxia inducible factor 1α C-terminal activation domain fusion peptide L63A mutant in complex with the CREB-binding protein TAZ1 domain: TAZ1	This paper	BMRB 50867
Backbone chemical shift assignments: CITED2 C-terminal activation domain - Hypoxia inducible factor 1α C-terminal activation domain fusion peptide L63A mutant in complex with the CREB-binding protein TAZ1 domain: fusion peptide	This paper	BMRB 50867
Experimental Models: Cell Lines
Experimental Models: Organisms/Strains
Oligonucleotides
PCR Primer: 5’-gtccgcggtgatagaaatgggtttggaccgcatcaaggag (fusion peptide L21A mutation)	This paper; Integrated DNA Technologies	N/A
PCR Primer: 5’-caaacccatttctatcaccgcggacataagaacttcctcgtcgatgaaatcagtg (fusion peptide L21A mutation)	This paper; Integrated DNA Technologies	N/A
PCR Primer: 5’-gctgcggatcaagttaactgatagggatcccctctagaaa (fusion peptide L63A mutation	This paper; Integrated DNA Technologies	N/A
PCR Primer: 5’-aacttgatccgcagctctgagtaattcttcaccctgcag (fusion peptide L63A mutation)	This paper; Integrated DNA Technologies	N/A

Recombinant DNA
pET21d encoding M. musculus CREB-binding protein TAZ1 domain	De Guzman et al., 2005	Addgene #173760
dnaY	Love et al., 2004, Brinkmann et al., 1989	N/A
pET22b encoding M. musculus CREB-binding protein TAZ1 domain and the His₆-tagged B1 domain of streptococcal protein G fused to the C-terminal activation domain of H. sapiens hypoxia-inducible factor 1α	Sugase et al., 2008	Addgene #99343
pET22b encoding M. musculus CREB-binding protein TAZ1 domain and the His₆-tagged B1 domain of streptococcal protein G fused to the C-terminal activation domain of H. sapiens CITED2	Berlow et al., 2017	Addgene #173761
pET22b encoding M. musculus CREB-binding protein TAZ1 domain and the His₆-tagged B1 domain of streptococcal protein G fused to a H. sapiens CITED2 C-terminal activation domain – H. sapiens hypoxia-inducible factor 1α C-terminal activation domain fusion	This manuscript	Addgene #173762
pET22b encoding M. musculus CREB-binding protein TAZ1 domain and the His₆-tagged B1 domain of streptococcal protein G fused to a H. sapiens CITED2 C-terminal activation domain – H. sapiens hypoxia-inducible factor 1α C-terminal activation domain fusion harboring the L21A mutation	This manuscript	Addgene #173763
pET22b encoding M. musculus CREB-binding protein TAZ1 domain and the His₆-tagged B1 domain of streptococcal protein G fused to a H. sapiens CITED2 C-terminal activation domain – H. sapiens hypoxia-inducible factor 1α C-terminal activation domain fusion harboring the L63A mutation	This manuscript	Addgene #173764
Software and Algorithms
NmrPipe	Delaglio et al., 1995	https://www.ibbr.umd.edu/nmrpipe/install.html
NMRbox	Maciejewski et al., 2017	https://nmrbox.org
NMRFAM-SPARKY	Lee et al., 2015	https://nmrfam.wisc.edu/nmrfam-sparky-distribution
Bruker Topspin 3.2	www.Bruker.com	https://www.bruker.com/en/products-and-solutions/mr/nmr-software/topspin.html
Bruker XWIN-NMR 3.1	www.Bruker.com	www.Bruker.com
Phenix	Liebschner et al., 2019	https://www.phenix-online.org
Coot	Emsley et al., 2010	https://www2.mrc-lmb.cam.ac.uk/personal/pemsley/coot
HKL-2000	Otwinowski and Minor, 1997	https://www.hkl-xray.com
Arcimboldo Lite	Sammito et al., 2015	chango.ibmb.csic.es/lite
Pymol	https://pymol.org/2/	https://pymol.org/2/
gnuplot	www.gnuplot.info	www.gnuplot.info
GNU Octave	Eaton et al., 2021	https://octave.org/doc/v6.2.0/
Other