Table 1.
Genomic profile of KO cells assessed by ICE Synthego analysis
| Gene | sgRNA sequence | Indel % | KO score | Indel pattern |
|---|---|---|---|---|
| IFNAR1 | AAACACTTCTTCATGGTATG | 99 | 99 | 99% + 1 |
| OAS1 | CTGAAGGAAAGGTGCTTCCG | 96 | 96 | 49% + 2 47% + 1 |
| ATR | AAAGTGCTAGCTGGTTGTGC | 63 | 63 | 35% −2 33% 0 28% −13 |
| LDLR | GACAACGGCTCAGACGAGCA | 93 | 93 | 48% + 1 45% −11 |
Isogenic cells were harvested for genomic DNA extraction. The sgRNA targeted region was PCR amplified and sent for Sanger sequencing. The sequencing results were then analyzed using ICE Synthego.