KEY RESOURCES TABLE.
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| OxPhos Antibody Cocktail Rodent | Invitrogen | Cat#458099, RRID:AB_2533835 |
| NDUFA9 Monoclonal Antibody | Invitrogen | Cat#459100, RRID:AB_2532223 |
| UQCRC1 Monoclonal Antibody | Invitrogen | Cat#459140, RRID:AB_2532227 |
| COX IV (3E11) Rabbit mAb | Cell Signaling | Cat#4850S, RRID:AB_2085424 |
| COX7C Polyclonal Antibody | Invitrogen | Cat#PA551284 RRID:AB_2636731 |
| NDUFA4 Polyclonal Antibody | Invitrogen | Cat#PA599439, RRID:AB_2818372 |
| COX5A Polyclonal Antibody | Proteintech | Cat# 11448–1-AP, RRID:AB_2085429 |
| α/β-Tubulin Antibody | Cell Signaling | Cat#2148S, RRID:AB_2288042 |
| Myc-Tag (9B11) Mouse mAb | Cell Signaling | Cat# 2276S, RRID:AB_331783 |
| Monoclonal ANTI-FLAG® M2 antibody | Sigma | Cat#F3165, RRID:AB_259529 |
| Goat anti-Mouse IgG2a Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 | Invitrogen | Cat# A21131, RRID:AB_141618 |
| Goat anti-Mouse IgG1 Cross-Adsorbed Secondary Antibody, Alexa Fluor 568 | Invitrogen | Cat# A21124, RRID:AB_141611 |
| Goat anti-Mouse IgG1 Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 | Invitrogen | Cat# A21121, RRID:AB_2535764 |
| Goat anti-Mouse IgG2a Cross-Adsorbed Secondary Antibody, Alexa Fluor 568 | Invitrogen | Cat# A21134, RRID:AB_1500825 |
|
Chemicals, peptides, and recombinant proteins | ||
| 15N-spirulina algae | Cambridge isotope Laboratories | Cat#MF-SPIRULINA-N-S |
| 2.5% Glutaraldehyde | Ted Pella Inc., Redding, CA | Cat#18426 |
| 2% Formaldehyde | Ted Pella Inc., Redding, CA | Cat#18200 |
| Sodium Cacodylate | Ted Pella Inc., Redding, CA | Cat#18851 |
| Osmium Tetroxide | Electron Microscopy Sciences | Cat#19190 |
| Potassium Ferrocyanide | Electron Microscopy Sciences | Cat#3114 |
| Thiocarbohydrazide | Electron Microscopy Sciences | Cat#21900 |
| Durcupan ACM Resin | Sigma-Aldrich | Cat#44611 (Comp A), Cat# 44612 (Comp B), Cat#44613 (Comp C), Cat#44614 (Comp D). |
| Matrigel (Cultrex) | R&D Systems | Cat#3433–005-01 |
| DMEM:F12 for SILAC | Fisher Scientific | Cat#88370 |
| Dialyzed FBS | Gibco | Cat#26400044 |
| DMEM for SILAC | Fisher Scientific | Cat#A33822 |
| L-Lysine-13C6 hydrochloride | Sigma | Cat#643459 |
| L-Arginine-13C6,15N4 hydrochloride | Sigma | Cat#608033 |
| TCEP-HCL | Sigma-Aldrich | Cat#C4706 |
| Chloroacetamide | Sigma-Aldrich | Cat#C0267 |
| Trypsin | Promega | Cat# V5111 |
| NativePAGE™ Sample Prep Kit | Invitrogen | Cat#BN2008 |
| Native PAGE 3–12% gradient gel | Invitrogen | Cat# BN1001BOX |
| Dark Blue Cathode Buffer | Invitrogen | Cat# BN2002 |
| Running Anode Buffer | Invitrogen | Cat#BN2001 |
| Trizol | Invitrogen | Cat#15596026 |
| SuperSignal West Pico | Fisher Scientific | Cat#PI34078 |
| SYBR Green PCR Master Mix | Applied Biosystems | Cat#4309155 |
| Ibidi u-Slide chambers | Ibidi | Cat#80826 |
| 4-hydroxytamoxifen (4OHT) | Sigma-Aldrich | Cat#H6278 |
| Critical commercial assays | ||
| RNeasy Mini Kit | Qiagen | Cat#74106 |
| QuantiTect Reverse Transcriptase Kit | Qiagen | Cat#205311 |
| Complex IV Rodent Enzyme Activity Microplate Assay Kit | Abcam | Cat# ab109911 |
| Seahorse XF Cell Mito Stress Test | Agilent | Cat#103015–100 |
| Seahorse XF Glycolysis Stress Test Kit | Agilent | Cat#103020–100 |
| ATP Chemiluminescence Detection Assay Kit | Cayman Chemicals | Cat# NC1357058 |
| L-Lactate Assay Kit | Abcam | Cat# ab65330 |
| Deposited Data | ||
| Mass spectrometry Proteomic Datasets | ProteomeXchange Consortium via PRIDE (Perez-Riverol et al., 2019) | DOI: 10.6019/PXD028963 |
| Experimental models: Cell lines | ||
| SH-SY5Y | ATCC | Cat#CRL-2266 |
| C2C12 Myoblasts | ATCC | Cat#CRL-1772 |
| Human ES Cells (H9) | WiCell | Cat#WA09 |
| Experimental models: Organisms/strains | ||
| Mouse:FVB (Male) | The Jackson Laboratory, Bar Harbor,ME | Stock No: 001800 |
| Oligonucleotides | ||
| COX7C sh1 targeting sequence - TGCTGTTGACAGTGAGCGACCGCACCTTTCTTTATAGTAATAGTGAAGCCACAGATGTATTACTATAAAGAAAGGTGCGGCTGCCTACTGCCTCGGA | This paper | Eton Biosciences; Sequences generated using shERWOOD algorithm (Knott et al., 2014) |
| COX7C sh2 targeting sequence - TGCTGTTGACAGTGAGCGCCACCAGCTACTTAAAAAATAATAGTGAAGCCACAGATGTATTATTTTTTAAGTAGCTGGTGTTGCCTACTGCCTCGGA | This paper | Eton Biosciences; Sequences generated using shERWOOD algorithm (Knott et al., 2014) |
| COX7C qPCR Primer: Forward - AGCATGTTGGGCCAGAGT | This paper | Eton Biosciences |
| COX7C qPCR Primer: Reverse-ACTGAAAACGGCAAATTCTT | This paper | Eton Biosciences |
| NDUFA4 qPCR Primer: Forward - CGCTTGGCACTGTTTAATCCA | This paper | Eton Biosciences |
| NDUFA4 qPCR Primer: Reverse - TCCATGGCTCTGGGTTGTTC | This paper | Eton Biosciences |
| COX5A qPCR Primer: Forward - CTGCCGCTGTCTGTTCCATTCG | This paper | Eton Biosciences |
| COX5A qPCR Primer: Reverse - TGTCACCCAGCGAGCATCAAACT | This paper | Eton Biosciences |
| Beta-actin qPCR Primer: Forward - CTGTCCCTGTATGCCTCTG | This paper | Eton Biosciences |
| Beta-actin qPCR Primer: Reverse - ATGTCACGCACGATTTCC | This paper | Eton Biosciences |
| Recombinant DNA | ||
| UNG Construct | Addgene | Cat#127288 |
| Plasmid: pRITE Myc to Flag (pRITE-MF) | (Toyama et al., 2019) | N/A |
| Plasmid: ATP5C1 RITE-MF pLentiCMVBlast | This paper | N/A |
| Plasmid: COX7C RITE-MF pLentiCMVBlast | This paper | N/A |
| shERWOOD UltramiR Lentiviral Inducible shRNA for NDUFA4 | Transomic technologies | Cat#TLMSU2300–17992 |
| Set of 3 SMARTvector Inducible Mouse COX5A (mCMV-TurboGFP shRNA) SMARTvector Inducible Lentiviral Control |
Dharmacon | Cat#V3SM11256–01EG12858 Cat# VSC11651 |
| Software and algorithms | ||
| OpenMIMS | (Steinhauser et al, 2012) | https://github.com/BWHCNI/OpenMIMS/ |
| Unwarp Plugin for ImageJ | (Schneider et al., 2012; Sorzano et al., 2005) | N/A |
| MesoFusion Plugin and Code for ImageJ | This paper; Mendeley Data | https://data.mendeley.com/datasets/b3hww8ng7w/1; DOI:10.17632/b3hww8ng7w.1 |
| Integrated Proteomics Pipeline Version 6.0.5 IP2 | N/A | http://www.integratedproteomics.com/ |
| Census2 | (Park et al., 2014) | N/A |
| nl2sol algorithm | R package | http://www.netlib.org/port/ |
| modelr algorithm | R package | https://CRAN.R-project.org/package=modelr |
| Proteomics Data Analysis Code (Mass spectrometry and half-life calculation) | This paper; Mendeley Data | https://data.mendeley.com/datasets/b3hww8ng7w/1; DOI:10.17632/b3hww8ng7w.1 |
| RCSB Protein Data Bank | https://www.rcsb.org/ | mouse Complex I: 6G2J, human Complex III: 5XTE, human Complex IV: 5Z62, porcine respirasome: 5XTH |
| PyMOL | PyMOL by Schrödinger | https://pymol.org/2/ |
| Half-life Color Code for PDB crystal structures in PyMOL | This paper; Mendeley Data | https://data.mendeley.com/datasets/b3hww8ng7w/1; DOI:10.17632/b3hww8ng7w.1 |
| Graphpad Prism 8.0 | Graphpad | https://www.graphpad.com/scientific-software/prism/; RRID: SCR_002798 |