Skip to main content
NCBI home page
Journal of Zhejiang University. Science. B logoLink to Journal of Zhejiang University. Science. B
. 2021 Dec 15;22(12):1034–1044. [Article in Chinese] doi: 10.1631/jzus.B2100393

ERα promotes transcription of tumor suppressor gene ApoA-I by establishing H3K27ac-enriched chromatin microenvironment in breast cancer cells

Bingjie WANG 1, Yinghui SHEN 1, Tianyu LIU 2, Li TAN 1,✉
PMCID: PMC8669322  PMID: 34904415

Abstract

Apolipoprotein A-I (ApoA-I), the main protein component of high-density lipoprotein (HDL), plays a pivotal role in reverse cholesterol transport (RCT). Previous studies indicated a reduction of serum ApoA-I levels in various types of cancer, suggesting ApoA-I as a potential cancer biomarker. Herein, ectopically overexpressed ApoA-I in MDA-MB-231 breast cancer cells was observed to have antitumor effects, inhibiting cell proliferation and migration. Subsequent studies on the mechanism of expression regulation revealed that estradiol (E2)/estrogen receptor α (ERα) signaling activates ApoA-I gene transcription in breast cancer cells. Mechanistically, our ChIP-seq data showed that ERα directly binds to the estrogen response element (ERE) site within the ApoA-I gene and establishes an acetylation of histone 3 lysine 27 (H3K27ac)‍-enriched chromatin microenvironment. Conversely, Fulvestrant (ICI 182780) treatment blocked ERα binding to ERE within the ApoA-I gene and downregulated the H3K27ac level on the ApoA-I gene. Treatment with p300 inhibitor also significantly decreased the ApoA-I messenger RNA (mRNA) level in MCF7 cells. Furthermore, the analysis of data from The Cancer Genome Atlas (TCGA) revealed a positive correlation between ERα and ApoA-I expression in breast cancer tissues. Taken together, our study not only revealed the antitumor potential of ApoA-I at the cellular level, but also found that ERα promotes the transcription of ApoA-I gene through direct genomic effects, and p300 may act as a co-activator of ERα in this process.

Keywords: Apolipoprotein A-I (ApoA-I), Estrogen receptor α (ERα), Acetylation of histone 3 lysine 27 (H3K27ac), p300, Breast cancer

1. Introduction

According to the 2020 World Health Organization (WHO) report, the number of new breast cancer cases surpassed that of lung cancer for the first time, which means that breast cancer had become the world's most common cancer. Based on molecular characteristics, breast cancers are divided into hormone receptor (estrogen receptor (ER)/progesterone receptor (PR))‍-positive/Erb-B2 receptor tyrosine kinase 2 (ERBB2)‍-negative (70% of patients), ERBB2-positive (15%–20%), and triple-negative subtypes (15%) (Waks and Winer, 2019).

Estrogen signaling modulates a variety of physiological processes through the direct or indirect regulation of target gene transcription (Vrtačnik et al., 2014). The abnormal overactivation of ERs may lead to the development of breast cancer, and the specific underlying mechanisms include: (1) amplification of ER coactivators (Anzick et al., 1997); (2) inhibition of ER corepressors (Mussi et al., 2006); (3) overexpressed bridge proteins promoting the recruitment of coactivators by ERs (Zwijsen et al., 1998; McMahon et al., 1999); (4) the mutations of ER enabling it to be activated at a lower concentration of estrogen (Herynk and Fuqua, 2004); and (5) ER localization on the plasma membrane and the subsequent signaling cascade activation (Levin and Pietras, 2008). Breast cancer patients with ERα-positive tumors are treated with endocrine therapy; however, most of them will develop endocrine resistance (Hanker et al., 2020). This prompts us to conduct a deeper investigation about the complex role of ERα in breast cancer. It has been reported that ERα can inhibit programmed death-ligand 1 (PD-L1) expression in breast cancer cells (Liu et al., 2018), which suggests the double-edged sword role of ERα. Investigations of ERα regulation of cancer-related genes will contribute to the clinical treatment of breast cancer.

Apolipoprotein A-I (ApoA-I) is the main protein component of high-density lipoprotein (HDL) (Shao and Heinecke, 2018). In addition to its well-known function in reverse cholesterol transport (RCT) and protective effect against cardiovascular diseases, ApoA-I is involved in inflammatory and immune responses (Gordon et al., 2011). Many recent studies have discovered a reduction of serum ApoA-I in various types of cancer (Georgila et al., 2019). The decrease of serum ApoA-I level has been related to the progression and metastasis of breast cancer (Gonçalves et al., 2006). Besides, a positive correlation between the level of serum ApoA-I secreted in tumor tissue fluid and chemotherapy sensitivity was observed in breast cancer (Cortesi et al., 2009; Zhang et al., 2016). ApoA-I contains ten consecutive helical domains, which are essential for the biophysical properties of proteins that spontaneously dissolve lipids in an aqueous environment (Li et al., 1988). Based on the characteristics of these amphiphilic helical sequences, researchers have synthesized various peptides that do not share any sequence homology, but all mimic the function of ApoA-I (Reddy et al., 2014). The ApoA-I mimetic peptide D-4F has been proved effective in reducing proliferative response induced by oxidized low-density lipoprotein (oxLDL) in human breast adenocarcinoma cells (Cedó et al., 2016).

Although numerous studies have shown that ApoA-I is a potential biomarker with antitumor effects, the regulatory mechanism of its expression in breast cancer remains unclear. Exploring the regulation of ApoA-I expression will help us to better manipulate its level and function, which may contribute to prevention and treatment strategies for breast cancer. Herein, we explored the biological effect of ApoA-I on breast cancer cells and uncovered the effect of estradiol (E2)/ERα signaling on ApoA-I transcription in breast cancer.

2. Materials and methods

2.1. Vector construction and cell transfection

The human breast cancer cell lines MCF7 and MDA-MB-231 were purchased from the Chinese Academy of Sciences Cell Bank (Shanghai, China). The human breast cancer cell line BT549 was obtained from Dr. Sulin LIU (Fudan University Cancer Hospital, Shanghai, China). The 293T cell line was kindly provided by Dr. Degui CHEN (Shanghai Institution of Biochemistry and Cell Biology, Chinese Academy of Sciences, Shanghai, China). All cell lines used in this study were cultured in Dulbecco's modified Eagle's medium (DMEM) high-glucose medium (HyClone, Marlborough, MA, USA) supplemented with 10% (volume fraction) fetal bovine serum (FBS; BI, Israel) and 1% (volume fraction) penicillin/streptomycin (Gibco, Carlsbad, CA, USA). The cells were placed in a humidified incubator at 37 °C under 5% CO2 atmosphere. The following compounds were used in the corresponding experiments: 500 nmol/L ICI 182780 treatment for 7 d (Fulvestrant, Sigma-Aldrich, Darmstadt, Germany); 1 nmol/L E2 treatment for 2 d (Sigma-Aldrich) after 5 d of hormone deprivation; 20 μmol/L histone acetyltransferase inhibitor II (Selleck, Houston, Texas, USA).

2.2. Cell culture and treatment procedure

The coding sequences (CDSs) of ApoA-I and ERα amplified from the complementary DNAs (cDNAs) of MCF7 cells were separately inserted into a pLenti6.2/v5/TEV vector (Clonetech, Waltham, MA, USA). The recombinant plasmids and packaging plasmids were transfected into 293T cells using LipofectamineTM 2000 Transfection Reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's protocol. After 48 h of transfection, the cell supernatant was collected and filtered. Virus-containing supernatant containing 0.1% (volume fraction) polybrene (Sigma-Aldrich) was added to 1.5×106 MDA-MB-231 cells seeded in a six-well plate. After 48 h of infection, cells were screened using 10 μg/mL Blasticidin S HCl (Gibco).

2.3. qRT-PCR analysis

Total RNA was extracted from breast cancer cells using the TRIzol® reagent (Ambion, Life Technologies, Carlsbad, CA, USA) and quantified by a NanoDrop 2000 spectrophotometer (Thermo Scientific, Waltham, MA, USA). Total RNA was reverse-transcribed into cDNA using a PrimescriptTM RT Reagent Kit with genomic DNA (gDNA) eraser (TaKaRa, Kusatsu, Japan) according to the manufacturer's protocol. The cDNA was subjected to quantitative real-time polymerase chain reaction (qRT-PCR) amplification by using the SYBR Green Master Mix (Roche, Basel, Switzerland) and performing in triplicates on a Roche LightCycler 480 II system. Table 1 shows the primer sequences used in this study.

Table 1.

Primer sequences of target gens in this study

Target gene Primer sequence (5'→3')
GAPDH F: CTGACTTCAACAGCGACACC
R: GTGGTCCAGGGGTCTTACTC
ApoA-I F: TGAGGCTCTCAAGGAGAACG
R: CCTCACTGGGTGTTGAGCTT
GREB1 F: GACCAGCTTCTGATCACCCC
R: TACCTAAAGCCGATGGTCGC
ERα F: CCTCCTCATCCTCTCCCACA
R: ATGCGATGAAGTAGAGCCCG
ApoA-I_ChIP-qPCR F: GCCTTCAAACTGGGACACAT
R: CATTTCTGGCAGCAAGATGA
Open in a new tab

GAPDH: glyceraldehyde-3-phosphate dehydrogenase; ApoA-I: apolipoprotein A-I; GREB1: growth regulation by estrogen in breast cancer 1; ERα: estrogen receptor α; F: forward; R: reverse.

2.4. Western blot

Cells were harvested and lysed using sodium dodecyl sulfate (SDS) lysis buffer containing protease inhibitors. Equal amounts of proteins were separated by SDS-polyacrylamide gel electrophoresis (PAGE) and transferred onto nitrocellulose membrane using a wet-transfer system (Bio-Rad, Hercules, CA, USA). After 1 h of blocking, the membranes were placed in bovine serum albumin (BSA) solution at 4 ℃ overnight with the following primary antibodies: anti-‍β‍-actin (Proteintech, Rosemont, IL, USA; 66009-1-Ig), anti-vinculin (Cell Signaling Technology, Boston, MA, USA; 13901), anti-ApoA-I (Abcam, Cambridge, UK; ab52945), anti-ERα (Cell Signaling Technology; 8644), and anti-H3K27ac (Active Motif, Shanghai, China; 39133). After washing with Tris-buffered saline (TBS)/Tween buffer, the appropriate secondary antibodies (L3012: horseradish peroxidase (HRP)‍-conjugated goat anti-rabbit immunoglobulin G (IgG) secondary antibody; L3032: HRP-conjugated goat anti-mouse IgG secondary antibody) were used for blocking at room temperature for 1 h. The expression levels of proteins were detected by the ChemiDoc Touch Imaging System (Bio-Rad).

2.5. CCK-8 and transwell assay

The cell counting kit-8 (CCK-8) experiments were carried out with 2000 cells in accordance with the kit instructions (Enhanced Cell Counting Kit-8; Beyotime, Shanghai, China). Specifically, 2000 cells were planted in each well of the 96-well plate. After 0, 1, 2, 3, and 4 d, the medium was removed, and 100 μL of medium containing 10 µL CCK-8 solution was added to react in the cell incubator for 2 h. The absorbance was subsequently measured at 450 nm.

For the transwell assay, 5×104 cells were placed on the upper layer of a cell culture insert with a cell permeable membrane (Millicell Hanging Cell Culture Inserts, 8.0 μm polyethylene terephthalate (PET); Millipore, Massachusetts, USA), and DMEM high-glucose medium containing 20% (volume fraction) FBS (BI) and 1% (volume fraction) penicillin/streptomycin (Gibco) was placed below the membrane. Following an 8-h incubation period, the cells that had migrated through the membrane were stained and counted.

2.6. ChIP-seq and ChIP-qPCR

This experiment was performed as previously described (Kong et al., 2016). In particular, the monolayer of cultured cells was fixed with 1% (volume fraction) formaldehyde for 8 min, which process was terminated by 2.5 mol/L glycine solution for 5 min. After washing with phosphate-buffered saline (PBS), cells were harvested and lysed using a cocktail containing high-salt and lysis buffer (50 mmol/L 4-(2-hydroxyerhyl)piperazine-1-erhanesulfonic acid (HEPES; pH 7.5), 500 mmol/L NaCl, 1 mmol/L ethylenediamine tetraacetic acid (EDTA), 0.001 g/mL Na-deoxycholate, 1% (volume fraction) Triton X-100, 0.001 g/mL SDS) (Roche). Next, the cell lysate was sonicated for 30 min (30 s on, 40 s off, 95% amplify) using a Bioruptor® sonicator (Diagenode, Belgium). The 10% (volume fraction) supernatant was taken out as the control group. The 2 μL of ERα or H3K27ac antibody (Active Motif) was added to the remaining sonicated chromatin for rotating overnight at 4 ℃. Then, 15 μL protein A/G magnetic beads (Invitrogen) were added to bind to the antibody at 4 °C for 2 h. The beads were washed according to the following method: thrice with high-salt and lysis buffer, twice with low-salt buffer (10 mmol/L Tris-Cl (pH 8.0), 250 mmol/L LiCl, 1 mmol/L EDTA, 0.001g/mL Na-deoxycholate, and 0.5% (volume fraction) NP-40), and once with TE buffer (2 mmol/L EDTA, 10 mmol/L Tris-Cl (pH 8.0)). The "beads" and the control group were resuspended in 100 μL elution and de-crosslink buffer (50 mmol/L Tris-Cl (pH 8.0), 10 mmol/L EDTA, and 0.01g/mL SDS) and incubated at 65 ℃ on the oscillator for 6 h. Chromatin was eluted by 60 μL of DNA elution buffer (10 mmol/L Tris-Cl, pH 8.0) containing 20 μg of proteinase A for 2 h at 37 ℃ and 20 μg of protease K for 1 h at 55 ℃. The DNA was purified using a MinElute® PCR purification kit (Qiagen, Valencia, CA, USA). A ChIP-seq library was constructed using KAPA HyperPrep Kits (KAPA, Boston, MA, USA) according to the manufacture's protocol. Sequencing was completed by Basepair Biotechnology Co., Ltd. (Suzhou, China). The ChIP-qPCR experiment was performed as described above.

Our own raw and processed nucleic acid sequencing data (ERα and H3K27ac ChIP-seq) were deposited in the National Center for Biotechnology Information (NCBI) Gene Expression Omnibus (GEO) (https://www.ncbi.nlm.nih.gov/geo) under the accession number GSE136673.

2.7. TCGA data analysis

The data analysis was carried out by the method described in the previous article published by our group (Liu et al., 2018). In short, The Cancer Genome Atlas (TCGA) data were downloaded from http://www.cbioportal.org. The expression of ERα in tumor samples was determined based on clinical data.

2.8. Statistical analysis

The results derived from three independent experiments were presented as mean±standard deviation (SD). The significance of the data was analyzed with GraphPad Prism 8.2.1 by a two-tailed unpaired t-test. The difference was considered significant when P<0.05.

3. Results

3.1. Proliferation and migration of MDA-MB-231 cells inhibited by ectopic overexpression of ApoA-I

In order to investigate the effect of ApoA-I on the biological behavior of breast cancer cells, we first determined the messenger RNA (mRNA) levels of ApoA-I in three breast cancer cell lines (Fig. 1a). Since the mRNA level of ApoA-I in MDA-MB-231 cells is the lowest, we constructed an ectopic ApoA-I-overexpression system in MDA-MB-231 cells (Fig. 1b). Then, we performed CCK-8 and transwell experiments to detect the effect of ApoA-I overexpression on MDA-MB-231 cells. The CCK-8 test result showed that the proliferation rate of ApoA-I-overexpressed MDA-MB-231 cells was significantly lower than that of the control group (Fig. 1c). Furthermore, ApoA-I inhibited the migration of MDA-MB-231 cells (Figs. 1d and 1e). This result indicated that ApoA-I may be a tumor suppressor that can inhibit the proliferation and migration of breast cancer cells.

Fig. 1. Apolipoprotein A-I (ApoA-I) inhibits the proliferation and migration of MDA-MB-231 cells. (a) The ApoA-I messenger RNA (mRNA) levels in three different breast cancer cell lines were analyzed by quantitative real-time polymerase chain reaction (qRT-PCR). (b) The protein levels of ApoA-I in mock (control) and ApoA-I-overexpressed (OE) MDA-MB-231 cells were analyzed by western blotting. (c) The proliferation rates of mock and ApoA-I-OE MDA-MB-231 cells were analyzed by cell counting kit-8 (CCK-8). (d) Stained images of cells passing through the pore show the representative data of three independent transwell experiments. The scale bar is 50 μm. (e) Statistics of the number of cells passing through the pore in three independent transwell experiments. All data are derived from three independent experiments and presented as mean±standard deviation (SD). ns P ≥ 0.05, ** P<0.01, *** P<0.001, **** P<0.0001. GAPDH: glyceraldehyde-3-phosphate dehydrogenase; OD450: optical density at 450 nm.

Fig. 1

Open in a new tab

3.2. ApoA-I transcription induced by E2/ERα signaling in breast cancer cells

In order to explore whether E2/ERα signaling modulates ApoA-I transcription, we exposed ERα‍-positive MCF7 cells to estrogen antagonist ICI 182780 to abolish the ERα functions. Accompanied by a decrease of ERα (Fig. 2a), the mRNA levels of growth regulation by estrogen in breast cancer 1 (GREB1; the classic ERα target gene) and ApoA-I in MCF7 cells were significantly downregulated by ICI 182780 (Fig. 2b).

Fig. 2. Estradiol (E2)/estrogen receptor α (ERα) signaling induces apolipoprotein A-I (ApoA-I) transcription in breast cancer cells. (a) The ERα protein levels in dimethyl sulfoxide (DMSO) or ICI 182780-treated MCF7 cells were analyzed by western blotting. (b) Messenger RNA (mRNA) levels of growth regulation by estrogen in breast cancer 1 (GREB1) and ApoA-I in DMSO or ICI 182780-treated MCF7 cells were analyzed by quantitative real-time polymerase chain reaction (qRT-PCR). (c) GREB1 and ApoA-I mRNA levels in hormone-depleted MCF7 cells treated with ethanol (EtOH) or E2 were analyzed by qRT-PCR. (d) The expression levels of ERα in mock (control) and ERα-overexpressed (OE) MDA-MB-231 cells were analyzed by western blotting. (e) The ApoA-I mRNA levels in mock and ERα‍-OE MDA-MB-231 cells were analyzed by qRT-PCR. All data are derived from three independent experiments and presented as mean±standard deviation (SD). ** P<0.01, *** P<0.001, **** P<0.0001. GAPDH: glyceraldehyde-3-phosphate dehydrogenase.

graphic file with name JZhejiangUnivSciB-22-12-1034-g002a.jpg

graphic file with name JZhejiangUnivSciB-22-12-1034-g002b.jpg

Open in a new tab

Given that the ER inhibitor downregulated the ApoA-I mRNA level in MCF7 cells, we speculated that the activation of ERα signaling would promote the transcription of ApoA-I. We performed hormone deprivation on ER-positive MCF7 cells, and then added an equal volume of ethanol (EtOH, vehicle control) or E2. Our results showed that the transcription of both GREB1 and ApoA-I was dramatically upregulated by E2 (Fig. 2c). Compared with ER-positive MCF7 cells, triple-negative BT549 and MDA-MB-231 cells had lower ApoA-I mRNA levels (Fig. 1a). We hypothesized that ectopic expression of ERα would also activate ApoA-I transcription in ER-negative breast cancer cells. As expected, the western blotting and qRT-qPCR data showed that the restoration of ERα expression in MDA-MB-231 cells upregulated the mRNA level of ApoA-I (Figs. 2d and 2e).

3.3. ERα directly binds to last exon of ApoA-I gene

In order to examine whether ERα has a direct role in regulating ApoA-I transcription, ChIP-seq was conducted using anti-ERα antibodies. We observed that ERα was enriched in the last exon of the ApoA-I gene in both MCF7 and ERα-overexpressed MDA-MB-231 cells (Fig. 3a). Notably, when challenging hormone-depleted MCF7 cells with E2, the ChIP signal intensity of ERα on the ApoA-I gene was more significant than that of hormone-depleted MCF7 cells treated with EtOH (Fig. 3a). In addition, by analyzing the ERα‍-enriched region, we found that an estrogen response element (ERE) was located right in the center of the ERα peak (Fig. 3b).

Fig. 3. Estrogen receptor α (ERα) directly binds to last exon of apolipoprotein A-I (ApoA-I) gene. (a) UCSC (University of California, Santa Cruz) Genome Brower tracks for ApoA-I from ChIP-seq analysis showing representative data of three independent experiments; (b) Schematic diagram of estrogen response element (ERE) sequence and its location on ApoA-I gene. ERE is marked in red. EtOH: ethanol; E2: estradiol; ERα-OE: ERα-overexpressed.

Fig. 3

Open in a new tab

3.4. p300-mediated H3K27ac is involved in the transcriptional regulation of ApoA-I through ERα

Aimed at exploring the mechanism by which ERα regulates ApoA-I transcription, we analyzed the epigenetic characteristics of the ApoA-I gene. The increased H3K27ac signal intensity was observed in hormone-depleted MCF7 cells when treated with E2 (Fig. 4a). To further investigate the relationship between ERα and H3K27ac on the ApoA-I gene, we performed ChIP-qPCR using anti-H3K27ac antibodies. Our data showed that ICI 182780 significantly reduced the abundance of H3K27ac on the ApoA-I gene in MCF7 cells (Fig. 4b). These data suggested that the binding of ERα on the ApoA-I gene is positively correlated with the abundance of H3K27ac modification.

Fig. 4. p300-mediated acetylation of histone 3 lysine 27 (H3K27ac) is involved in the transcriptional regulation of apolipoprotein A-I(ApoA-I) by estrogen receptor α (ERα). (a) UCSC (University of California, Santa Cruz) Genome Brower tracks for ApoA-I from ChIP-seq analysis showing representative data of two independent experiments. Hormone-depleted MCF7 cells were treated with EtOH (MCF7_EtOH) or E2 (MCF7_E2) for 24 h. (b) ChIP-qPCR analysis of H3K27ac abundance on ApoA-I gene in MCF7 cells treated with dimethyl sulfoxide (DMSO) or ICI 182780 for 7 d. (c) Western blot analysis of the H3K27ac level in MCF7 cells treated with DMSO or p300 inhibitor (p300i) for 24 and 72 h. (d) Quantitative real-time polymerase chain reaction (qRT-PCR) analysis of ApoA-I messenger RNA (mRNA) levels in MCF7 cells treated with DMSO or p300i for 24 and 72 h. All data are derived from three independent experiments and presented as mean±standard deviation (SD). ns P ≥0.05, ** P<0.01, **** P<0.0001. EtOH: ethanol; E2: estradiol; GAPDH: glyceraldehyde-3-phosphate dehydrogenase.

Fig. 4

Open in a new tab

Subsequently, we tested the role of acetyltransferase p300 in this process. With the intervention of p300 inhibitor (p300i), the mRNA level of ApoA-I decreased significantly along with the decline of H3K27ac level (Figs. 4c and 4d). Specifically, challenging MCF7 cells with p300i for 24 and 72 h made the ApoA-I mRNA level drop by more than 90% and 98%, respectively (Fig. 4d).

3.5. Positive correlation between mRNA expression levels of ERα and ApoA-I in breast cancer

In order to support our findings with clinical data, we analyzed the TCGA data for breast cancer (TCGA-BRCA) uploaded by Perou (Ciriello et al., 2015). According to the examined clinical data, we separated samples into ERα‍-negative and ERα‍-positive groups (Fig. 5a). The average mRNA level of ApoA-I in the ERα-positive group was significantly higher than that in the ERα‍-negative group (Fig. 5b). Moreover, the regression analysis revealed a positive correlation between the mRNA expression levels of ERα and ApoA-I (Fig. 5c).

Fig. 5. Positive correlations between messenger RNA (mRNA) expression levels of estrogen receptor α (ERα) and apolipoprotein A-I(ApoA-I) in breast cancer. (a, b) The Cancer Genome Atlas (TCGA) data were analyzed for ERα (a) and ApoA-I (b) mRNA expression levels in ERα-negative (ERα - ) and ERα-positive (ERα+) breast cancer tissues. (c) Regression analysis of the correlation between ERα and ApoA-I mRNA levels in breast cancer tissues. * P<0.05, **** P<0.0001. TCGA-BRCA: TCGA data for breast cancer.

Fig. 5

Open in a new tab

4. Discussion

Numerous studies have suggested the downregulation of serum and tissue ApoA-I in various cancer types (Zamanian-Daryoush and Didonato, 2015). Therefore, it is of high importance to understand the role of this phenomenon and the associated regulatory mechanism. In this study, we demonstrated that ApoA-I can inhibit the proliferation and migration of breast cancer cells. Moreover, ERα could directly bind to the last exon of ApoA-I gene to active its transcription, and p300 might be a co-activator of ERα by establishing an H3K27ac-enriched chromatin microenvironment in this process.

The ApoA-I mimetic peptide D-4F has been proven to inhibit the proliferation of human breast cancer cells (Peng et al., 2017). We found that the direct overexpression of human ApoA-I protein arrived at the same result. The antitumor effect of ApoA-I may be achieved through a cellular autonomic mechanism, or its impact on immune responses (Gordon et al., 2011), or both, which remains an elusive topic. In the cellular autonomic mechanism, ApoA-I can induce changes in the expression of cancer-related genes, thus producing anti-cancer effects. For example, ApoA-I induces the downregulation of vascular endothelial growth factor (VEGF) and hypoxia-inducible factor (HIF)-1α expression, thereby inhibiting the proliferation and migration of ovarian cancer cells (Gao et al., 2011, 2012). In colorectal adenocarcinoma cells, ApoA-I inhibits the activity of cancer cells by downregulating cyclooxygenase-2 (COX-2) expression (Aguirre-Portolés et al., 2018). In our in vitro model, the anti-cancer effect is more likely to be achieved through the cellular autonomic mechanism due to the absence of an immune system. Nonetheless, the relevant specific mechanism remains to be further studied. Although most researches have indicated that ApoA-I levels are negatively correlated with the occurrence and progression of various types of cancer, there are also reports showing a positive correlation (Chen et al., 2013; Martin et al., 2015; Shi et al., 2018; Zografos et al., 2019). It is not clear whether the positive correlation between ApoA-I levels and cancer parameters as reported by a number of studies reflects the cancer-promoting effects of ApoA-I in these special cases.

Many transcription factors implicated in the regulation of ApoA-I promotor have been identified, including peroxisome proliferator-activated receptor γ (PPARγ), hepatocyte nuclear factor 4 (HNF4), liver receptor homologue-1 (LRH1), and ApoA-I regulatory protein 1 (ARP1)/nuclear receptor subfamily 2 group F member 2 (NR2F2) (Kardassis et al., 2014). Besides, an endogenously expressed long noncoding antisense transcript, ApoA1-AS, can also modulate ApoA-I transcription through recruiting histone methylation enzymes (Halley et al., 2014). Herein, for the first time, ERα was demonstrated to be an activator for ApoA-I gene transcription in breast cancer cells: we observed a positive correlation between the expressionof ERα and ApoA-I mRNAs, in both breast cancer cells cultured in vitro and breast tumor samples.

Estrogen can exert its function through both genomic and non-genomic signaling. Our ChIP-seq data displayed an ERα enrichment signal within the ApoA-I gene, suggesting that ERα promoted the transcription of ApoA-I gene through genomic signaling. Genomic signaling can be divided into direct and indirect types. In direct genomic signaling, dimerized ERα binds directly to specific DNA sequences known as EREs (Klinge, 2001). By analyzing the sequence of ERα enrichment locus on the ApoA-I gene, we found the sequence AGGTCACGCTGTCCC that has proved to be an ERE (Bourdeau et al., 2004). ERα seems to modulate ApoA-I transcription through direct genomic signaling, while this is suggested by the experiment through the process focusing on the influence of ERE sequence mutation.

Recruiting various co-regulators to form an ER complex is the intrinsic mechanism of estrogen signaling (Heldring et al., 2007). The activity of ERs depends on co-regulators within this complex. We found that H3K27ac abundance on the ApoA-I gene is tightly dependent on ERα. Moreover, the inhibitor of acetyltransferase p300 could suppress ApoA-I mRNA expression. We speculate that histone acetyltransferase p300 may be a co-activator of ERα by making the chromatin region containing ApoA-I more accessible to transcriptional factors. A recent study revealed that Ajuba, the LIM protein in MCF7 and T47D breast cancer cells, could recruit deleted in breast cancer 1 (DBC1) and cAMP-regulated enhancer-binding protein (CREB)‍-binding protein (CBP)/p300 to enhance the regulatory activity of ERα on target genes by acetylating ERα (Xu et al., 2019). We hypothesize that p300 may combine with ERα to enhance the transcriptional activity of ERα on ApoA-I, which process requires further verification.

5. Conclusions

This study revealed the tumor suppressive role of ApoA-I in breast cancer cells and identified ERα as a new activator of ApoA-I gene transcription through directly binding to the last exon of the ApoA-I gene. This is the site where an ERE sequence is found, and p300 may serve as a co-activator of ERα in activating ApoA-I expression by establishing an H3K27ac-enriched chromatin microenvironment. Our study demonstrated the mechanism of ERα promoting ApoA-I gene transcription in breast cancer cells, providing further supporting evidence of the double-edged nature of the E2/ERα signaling in tumorigenesis. Moreover, given the positive regulatory effect of ERα on ApoA-I expression and the tumor suppressive role of ApoA-I in various types of cancer, such as melanoma (Zamanian-Daryoush et al., 2013), breast cancer (Cedó et al., 2016), colon cancer (Gkouskou et al., 2016), and pancreatic cancer (Peng et al., 2017), it is considered that the administration of ApoA-I mimetic peptides may enhance the efficacy of systemic therapy for luminal breast cancer.

Acknowledgments

This work was supported by the National Natural Science Foundation of China (Nos. 81672785, 31871291, and 82073113 to Li TAN) and the National Key R&D Project of China (No. 2016YFA0101800 to Li TAN). Li TAN was also supported by the Innovative Research Team of High-level Local University in Shanghai. We thank Dr. Xuguo ZHU (Institutes of Biomedical Sciences, Fudan University, Shanghai, China) for constructing the ERα‍-overexpressed MDA-MB-231 cells, Dr. Ruitu LV (Department of Chemistry, University of Chicago, Chicago, IL, USA) for analyzing the ChIP-seq data, and Prof. Yujiang Geno SHI (Division of Endocrinology, Diabetes and Hypertension, Brigham and Women's Hospital, Harvard Medical School, Boston, USA) for his valuable comments.

Funding Statement

This work was supported by the National Natural Science Foundation of China (Nos. 81672785, 31871291, and 82073113 to Li TAN) and the National Key R&D Project of China (No. 2016YFA0101800 to Li TAN).

Author contributions

Bingjie WANG performed the experimental research and TCGA data analysis, wrote and edited the manuscript. Yinghui SHEN performed the ChIP-seq experiment. Tianyu LIU contributed to the data analysis, writing and editing of the manuscript. Li TAN contributed to the study design and editing of the manuscript. All authors have read and approved the final manuscript, and therefore, have full access to all the data in the study and take responsibility for the integrity and security of the data.

Compliance with ethics guidelines

Bingjie WANG, Yinghui SHEN, Tianyu LIU, and Li TAN declare that they have no conflict of interest.

This article does not contain any studies with human or animal subjects performed by any of the authors.

References

  1. Aguirre-Portolés C, Feliu J, Reglero G, et al. , 2018. ABCA1 overexpression worsens colorectal cancer prognosis by facilitating tumour growth and caveolin-1-dependent invasiveness, and these effects can be ameliorated using the BET inhibitor apabetalone. Mol Oncol, 12(10): 1735-1752. 10.1002/1878-0261.12367 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Anzick SL, Kononen J, Walker RL, et al. , 1997. A1B1, a steroid receptor coactivator amplified in breast and ovarian cancer. Science, 277(5328): 965-968. 10.1126/science.277.5328.965 [DOI] [PubMed] [Google Scholar]
  3. Bourdeau V, Deschênes J, Métivier R, et al. , 2004. Genome-wide identification of high-affinity estrogen response elements in human and mouse. Mol Endocrinol, 18(6): 1411-1427. 10.1210/me.2003-0441 [DOI] [PubMed] [Google Scholar]
  4. Cedó L, García-León A, Baila-Rueda L, et al. , 2016. ApoA-I mimetic administration, but not increased apoA-I-containing HDL, inhibits tumour growth in a mouse model of inherited breast cancer. Sci Rep, 6: 36387. 10.1038/srep36387 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Chen CL, Lin TS, Tsai CH, et al. , 2013. Identification of potential bladder cancer markers in urine by abundant-protein depletion coupled with quantitative proteomics. J Proteomics, 85: 28-43. 10.1016/j.jprot.2013.04.024 [DOI] [PubMed] [Google Scholar]
  6. Ciriello G, Gatza ML, Beck AH, et al. , 2015. Comprehensive molecular portraits of invasive lobular breast cancer. Cell, 163(2): 506-519. 10.1016/j.cell.2015.09.033 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Cortesi L, Barchetti A, de Matteis E, et al. , 2009. Identification of protein clusters predictive of response to chemotherapy in breast cancer patients. J Proteome Res, 8(11): 4916-4933. 10.1021/pr900239h [DOI] [PubMed] [Google Scholar]
  8. Gao F, Vasquez SX, Su F, et al. , 2011. L-5F, an apolipoprotein A-I mimetic, inhibits tumor angiogenesis by suppressing VEGF/basic FGF signaling pathways. Integr Biol, 3(4): 479-489. 10.1039/c0ib00147c [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Gao F, Chattopadhyay A, Navab M, et al. , 2012. Apolipoprotein A-I mimetic peptides inhibit expression and activity of hypoxia-inducible factor-1α in human ovarian cancer cell lines and a mouse ovarian cancer model. J Pharmacol Exp Ther, 342(2): 255-262. 10.1124/jpet.112.191544 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Georgila K, Vyrla D, Drakos E, 2019. Apolipoprotein A-I (ApoA-I), immunity, inflammation and cancer. Cancers, 11(8): 1097. 10.3390/cancers11081097 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Gkouskou KK, Ioannou M, Pavlopoulos GA, et al. , 2016. Apolipoprotein A-I inhibits experimental colitis and colitis-propelled carcinogenesis. Oncogene, 35(19): 2496-2505. 10.1038/onc.2015.307 [DOI] [PubMed] [Google Scholar]
  12. Gonçalves A, Esterni B, Bertucci F, et al. , 2006. Postoperative serum proteomic profiles may predict metastatic relapse in high-risk primary breast cancer patients receiving adjuvant chemotherapy. Oncogene, 25(7): 981-989. 10.1038/sj.onc.1209131 [DOI] [PubMed] [Google Scholar]
  13. Gordon SM, Hofmann S, Askew DS, et al. , 2011. High density lipoprotein: it's not just about lipid transport anymore. Trends Endocrinol Metab, 22(1): 9-15. 10.1016/j.tem.2010.10.001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Halley P, Kadakkuzha BM, Faghihi MA, et al. , 2014. Regulation of the apolipoprotein gene cluster by a long noncoding RNA. Cell Rep, 6(1): 222-230. 10.1016/j.celrep.2013.12.015 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Hanker AB, Sudhan DR, Arteaga CL, 2020. Overcoming endocrine resistance in breast cancer. Cancer Cell, 37(4): 496-513. 10.1016/j.ccell.2020.03.009 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Heldring N, Pike A, Andersson S, et al. , 2007. Estrogen receptors: how do they signal and what are their targets. Physiol Rev, 87(3): 905-931. 10.1152/physrev.00026.2006 [DOI] [PubMed] [Google Scholar]
  17. Herynk MH, Fuqua SAW, 2004. Estrogen receptor mutations in human disease. Endocr Rev, 25(6): 869-898. 10.1210/ER.2003-0010 [DOI] [PubMed] [Google Scholar]
  18. Kardassis D, Mosialou I, Kanaki M, et al. , 2014. Metabolism of HDL and its regulation. Curr Med Chem, 21(25): 2864-2880. 10.2174/0929867321666140303153430 [DOI] [PubMed] [Google Scholar]
  19. Klinge CM, 2001. Estrogen receptor interaction with estrogen response elements. Nucleic Acids Res, 29(14): 2905-2919. 10.1093/nar/29.14.2905 [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Kong LC, Tan L, Lv RT, et al. , 2016. A primary role of TET proteins in establishment and maintenance of De Novo bivalency at CpG islands. Nucleic Acids Res, 44(18): 8682-8692. 10.1093/nar/gkw529 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Levin ER, Pietras RJ, 2008. Estrogen receptors outside the nucleus in breast cancer. Breast Cancer Res Treat, 108(3): 351-361. 10.1007/s10549-007-9618-4 [DOI] [PubMed] [Google Scholar]
  22. Li WH, Tanimura M, Luo CC, et al. , 1988. The apolipoprotein multigene family: biosynthesis, structure, structure‒function relationships, and evolution. J Lipid Res, 29(3): 245-271. 10.1016/S0022-2275(20)38532-1 [DOI] [PubMed] [Google Scholar]
  23. Liu L, Shen YH, Zhu XG, et al. , 2018. ERα is a negative regulator of PD-L1 gene transcription in breast cancer. Biochem Biophys Res Commun, 505(1): 157-161. 10.1016/j.bbrc.2018.09.005 [DOI] [PubMed] [Google Scholar]
  24. Martin LJ, Melnichouk O, Huszti E, et al. , 2015. Serum lipids, lipoproteins, and risk of breast cancer: a nested case-control study using multiple time points. J Nat Cancer Inst, 107(5): djv032. 10.1093/jnci/djv032 [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. McMahon C, Suthiphongchai T, DiRenzo J, et al. , 1999. P/CAF associates with cyclin D1 and potentiates its activation of the estrogen receptor. Proc Natl Acad Sci USA, 96(10): 5382-5387. 10.1073/pnas.96.10.5382 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Mussi P, Liao L, Park SE, et al. , 2006. Haploinsufficiency of the corepressor of estrogen receptor activity (REA) enhances estrogen receptor function in the mammary gland. Proc Natl Acad Sci USA, 103(45): 16716-16721. 10.1073/pnas.0607768103 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Peng MY, Zhang Q, Cheng YN, et al. , 2017. Apolipoprotein A-I mimetic peptide 4F suppresses tumor-associated macrophages and pancreatic cancer progression. Oncotarget, 8(59): 99693-99706. 10.18632/oncotarget.21157 [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Reddy ST, Navab M, Anantharamaiah GM, et al. , 2014. Apolipoprotein A-I mimetics. Curr Opin Lipidol, 25(4): 304-308. 10.1097/MOL.0000000000000092 [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Shao BH, Heinecke JW, 2018. Quantifying HDL proteins by mass spectrometry: how many proteins are there and what are their functions? Expert Rev Proteomics, 15(1): 31-40. 10.1080/14789450.2018.1402680 [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Shi FY, Wu H, Qu K, et al. , 2018. Identification of serum proteins AHSG, FGA and APOA-I as diagnostic biomarkers for gastric cancer. Clin Proteomics, 15: 18. 10.1186/s12014-018-9194-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Vrtačnik P, Ostanek B, Mencej-Bedrač S, et al. , 2014. The many faces of estrogen signaling. Biochem Med, 24(3): 329-342. 10.11613/BM.2014.035 [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Waks AG, Winer EP, 2019. Breast cancer treatment: a review. JAMA, 321(3): 288-300. 10.1001/jama.2018.19323 [DOI] [PubMed] [Google Scholar]
  33. Xu BH, Li Q, Chen N, et al. , 2019. The LIM protein Ajuba recruits DBC1 and CBP/p300 to acetylate ERα and enhances ERα target gene expression in breast cancer cells. Nucleic Acids Res, 47(5): 2322-2335. 10.1093/nar/gky1306 [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Zamanian-Daryoush M, Didonato JA, 2015. Apolipoprotein A-I and cancer. Front Pharmacol, 6: 265. 10.3389/fphar.2015.00265 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Zamanian-Daryoush M, Lindner D, Tallant TC, et al. , 2013. The cardioprotective protein apolipoprotein A1 promotes potent anti-tumorigenic effects. J Biol Chem, 288(29): 21237-21252. 10.1074/jbc.M113.468967 [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Zhang JW, Cai Y, Hu HB, et al. , 2016. Nomogram basing pre-treatment parameters predicting early response for locally advanced rectal cancer with neoadjuvant chemotherapy alone: a subgroup efficacy analysis of FOWARC study. Oncotarget, 7(4): 5053-5062. 10.18632/oncotarget.6469 [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Zografos E, Anagnostopoulos AK, Papadopoulou A, et al. , 2019. Serum proteomic signatures of male breast cancer. Cancer Genomics Proteomics, 16(2): 129-137. 10.21873/cgp.20118 [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Zwijsen RML, Buckle RS, Hijmans EM, et al. , 1998. Ligand-independent recruitment of steroid receptor coactivators to estrogen receptor by cyclin D1. Genes Dev, 12(22): 3488-3498. 10.1101/gad.12.22.3488 [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Zhejiang University. Science. B are provided here courtesy of Zhejiang University Press

RESOURCES