| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Rabbit anti-IMPA1 (use 1:10000 for western blot) | Abcam | ab184165 |
| Mouse anti-HDAC2 (use 1:1000 for western blot) | Abcam | ab12169 |
| Chemicals,peptides, andrecombinantproteins | ||
| Recombinant Ago2 | Active Motif | 31486 |
| Rat tail collagen | Homemade | n/a |
| PBS 0.0095M(PO4) w/o Ca and Mg | Lonza | BE17-516F |
| Protease Inhibitor Cocktail | Merck | P8340 |
| RNasin Plus Ribonuclease Inhibitor | Promega | N2611 |
| RNAseZap | Merck | R2020 |
| Calf Intestinal Phosphatase (CIP) | New England Biolabs | M0290S |
| Sodium Acetate buffer solution | Merck | S7899 |
| Linear acrylamide | Thermo Fisher Scientific | AM9520 |
| Phenol:Chloroform:Isoamyl Alcohol (25:24:1) | Fisher Scientific | 15875408 |
| Ethanol | Merck | 32221 |
| γ-32P ATP | PerkinElmer | BLU002A100UC |
| T4 Polynucleotide Kinase | Thermo Fisher Scientific | EK0031 |
| 0.5M EDTA pH 8 | Merck | E7889 |
| TRIzol Reagent | Thermo Fisher Scientific | 15596018 |
| RNA Loading Dye, (2×) | New England Biolabs | B0363S |
| ProtoGel (30% Solution at 37.5:1 Ratio) | GENEFLOW | EC-890 |
| Ammonium persulfate | Merck | A3678 |
| TEMED | VWR | 443083g |
| Trizma base | Merck | T1503 |
| Boric acid | Meck | B6768 |
| Urea | Merck | U5578 |
| HEPES Buffer, 1M Solution | Fisher Scientific | 83264 |
| Potassium hydroxide | Merck | 60377 |
| Potassium acetate | Merck | 60035 |
| Magnesium Acetate | Merck | M5661 |
| DL-Dithiothreitol | Merck | D9779 |
| Yeast tRNA (10 mg/mL) | Thermo Fisher Scientific | AM7119 |
| Experimentalmodels: Celllines | ||
| rat sympathetic neuron extracts | This paper | N/A |
| Experimentalmodels: Organisms/strains | ||
| Wild-type P0/P1 Wistar rats, either sex | N/A | N/A |
| Oligonucleotides | ||
| CTGACACATTAGAAGCAGGAATTGCAGCTTCA AGCACTCAGTGTGAGGTGTCGATTGGAGATCG CCTACTGTCTGACTGGCTCTGCACTAGGTGCT GTATTACAGTGATTAACCTGTCTC |
Sigma-Genosys | N/A |
| Other | ||
| NE-PER™ Nuclear and Cytoplasmic Extraction Reagents | Thermo Fisher Scientific | 78833 |
| Decade Markers System | Thermo Fisher Scientific | AM7778 |
| mirVana™ miRNA Probe Construction Kit | Thermo Fisher Scientific | AM1550 |