| Antibodies |
|
| Anti-V5 antibody (1:1000 dilution) |
Invitrogen |
R960-25 |
| Anti-beta Actin (1:1000 dilution) |
Abcam |
ab8227 |
| Anti-mouse IgG IRDye 680RD (1:10000 dilution) |
LI-COR Biosciences |
925-68070 |
| Anti-rabbit IgG IRDye 800RD (1:10000 dilution) |
LI-COR Biosciences |
926-32211 |
| Anti-biotin Streptavidin AlexaFluor680 (1:1000 dilution) |
Thermo Fisher Scientific |
S32358 |
|
| Recombinant DNA |
|
| pAAV-FLEx-ER-TurboID plasmid |
Addgene |
160857 |
|
| Chemicals, peptides, and recombinant proteins |
|
| Biotin |
Sigma-Aldrich |
B4501-1G |
| DTT |
Sigma-Aldrich |
D0632-1G |
| Sodium azide |
Sigma-Aldrich |
S2002-25G |
| Sodium chloride |
Sigma-Aldrich |
S9888-500G |
| Sodium deoxycholate |
Sigma-Aldrich |
D6750-100G |
| Sodium dodecyl sulfate |
Thermo Fisher Scientific |
BP166-500 |
| Sodium carbonate |
Thermo Fisher Scientific |
S263-500 |
| Sodium bicarbonate |
Thermo Fisher Scientific |
187508 |
| Sodium ascorbate |
Thermo Fisher Scientific |
A0539500G |
| Dimethyl sulfoxide |
Sigma-Aldrich |
D8418-100ML |
| Potassium chloride |
Sigma-Aldrich |
P3911-500G |
| EDTA |
Sigma-Aldrich |
E9884-100G |
| Tris-HCl |
Sigma-Aldrich |
1185-53-1 |
| Acetonitrile |
Thermo Fisher Scientific |
A998-4 |
| HALT protease inhibitor |
Thermo Fisher Scientific |
78429 |
| NP-40 alternative |
Merck Millipore |
492016-100ML |
| Chloroform |
Thermo Fisher Scientific |
C607-4 |
| Ponceau S solution |
Sigma-Aldrich |
P7170-1L |
| NuPAGE MOPS SDS Running Buffer (20×) |
Invitrogen |
NP0001-02 |
| NuPAGE 4-12% Bis-Tris Protein Gels, 1.0 mm, 15-well |
Thermo Fisher Scientific |
NP0323BOX |
| Odyssey blocking buffer |
LI-COR Biosciences |
927-50000 |
| Seeblue plus 2 protein ladder |
Thermo Fisher Scientific |
LC5925 |
| NuPAGE™ LDS Sample Buffer (4×) |
Thermo Fisher Scientific |
NP0008 |
| Urea |
Sigma-Aldrich |
31K0038 |
| Acetone |
Thermo Fisher Scientific |
A184 |
| Formic acid |
Thermo Fisher Scientific |
A117-50 |
| Phosphoric acid |
Sigma-Aldrich |
345245-100ML |
| Trolox |
Sigma-Aldrich |
648471-500MG |
| 0.9% saline solution |
Teknova |
S5825 |
| TEAB solution (1M) |
Sigma-Aldrich |
T7408-100ML |
| Kolliphor EL |
Sigma-Aldrich |
C5135-500G |
| Trypsin |
Promega |
V5113 |
| Iodoacetamide |
Sigma-Aldrich |
A3221 |
|
| Critical commercial assays |
|
| SilverQuest™ Silver Staining Kit |
Thermo Fisher Scientific |
LC6070 |
| Trans-blot turbo RTA transfer kit, nitrocellulose |
Bio-Rad Laboratories |
1704271 |
|
| Experimental models: Organisms/strains |
|
| C57BL/6J (M. musculus) |
The Jackson Laboratory |
000664 |
|
Albumin-Cre mice |
The Jackson Laboratory |
003574 |
|
| Bacterial and virus strains |
|
| One Shot™ TOP10 Chemically Competent E. coli |
Invitrogen |
C404010 |
|
| Oligonucleotides |
|
| pENN forward: gcctctgctaaccatgttcatg |
Integrated DNA Technologies |
N/A |
| pENN reverse: gcagcgtatccacatag |
Integrated DNA Technologies |
N/A |
|
| Deposited data |
|
| Proteomic data |
This study |
ProteomeXchange: PXD021602
|
| Processed proteomic datasets |
Wei et al. (2021) |
N/A |
|
| Other |
|
| 3 kDa Molecular Weight Cutoff Filter |
Amicon |
UFC9003 |
| EcoRI |
New England Biolabs |
R0101S |
| HindIII |
New England Biolabs |
R0104S |
| SmaI |
New England Biolabs |
R0141S |
| S-Trap™ micro columns |
ProtiFi |
C02-micro-40 |
| Exel International Insulin Syringes |
Thermo Fisher Scientific |
14-841-32 |
| lithium heparin tube |
BD |
365985 |
| PrecisionGlide Needle 21G |
BD |
305129 |
| Exel International Insulin Syringes 29G |
Exel International |
14-841-32 |
| Tailveiner Restrainer for Mice |
BRAINTREE SCIENTIFIC, INC. |
TV-150 STD |
| Streptavidin magnetic beads |
Thermo Fisher Scientific |
65601 |
| Bulk tubes |
Thermo Fisher Scientific |
15340162 |
| Metal Bulk Beads |
Thermo Fisher Scientific |
15340158 |
| Benchmark BeadBlaster Homogenizer |
Thermo Fisher Scientific |
15-340-163 |
| Orbitrap Fusion Tribrid Mass Spectrometer |
Thermo Fisher Scientific |
N/A |
| NanoDrop Spectrophotometer |
Thermo Fisher Scientific |
ND-ONE-W |
| Dionex UltiMate 3000 RPLCnano system |
Thermo Fisher Scientific |
N/A |
| Acclaim PepMap 100 C18, 5-μm particles |
Thermo Fisher Scientific |
164213 |
| Acclaim™ PepMap™ 100 C18 HPLC Columns (75 μm, packed with 2-μm, 100-Å) |
Thermo Fisher Scientific |
164942 |