Table 1.
Effects of shortening the loop stem (F1c and B1c) on amplification efficiency and specificity.
Primers | F1c 5’ | F1c | Length(n.t.) | Tm (°C) | B1c 5’ | B1c | Length(n.t.) | Tm (°C) | TT (min) | FP |
---|---|---|---|---|---|---|---|---|---|---|
N1 | ctctgctcccttctgcgtaga | 21 | 63.0 | tgatgctgctcttgctttgctg | 22 | 60.4 | 40.0±1.1 | 2 | ||
N1(-3) | (-3) | tgctcccttctgcgtaga | 18 | 59.7 | (-4) | gctgctcttgctttgctg | 18 | 59.5 | 30.5±1.2 | 2 |
N1(-6) | (-6) | tcccttctgcgtaga | 15 | 51.7 | (-7) | gctcttgctttgctg | 15 | 51.9 | 34.3±0.6 | 3 |
N1(-9) | (-9) | cttctgcgtaga | 12 | 39.4 | (-10) | cttgctttgctg | 12 | 41.1 | 36.9±1.6 | 2 |
N2 | attcaaggctccctcagttgc | 21 | 62.4 | atcacattggcacccgcaatc | 21 | 63.6 | 23.6±1.9 | 1 | ||
N2(-5) | (-5) | aggctccctcagttgc | 16 | 57.7 | (-5) | attggcacccgcaatc | 16 | 57.1 | 17.9±0.8 | 1 |
N3 | cagtattattgggtaaacctt | 21 | 52.5 | atggcaaggaagacct | 16 | 53.6 | 28.0±2.3 | 2 | ||
N3(-2) | (-2) | gtattattgggtaaacctt | 19 | 48.8 | (-2) | ggcaaggaagacct | 14 | 49.8 | 28.3±4.5 | 1 |
N3(-4) | (-4) | attattgggtaaacctt | 17 | 46.0 | (-4) | caaggaagacct | 12 | 38.8 | 20.3±1.0 | 1 |
N3(-6) | (-6) | tattgggtaaacctt | 15 | 42.8 | (-6) | aggaagacct | 10 | 29.7 | 32.6±7.9 | 1 |
N4 | ggtgccaatgtgatctt | 17 | 53.9 | ctgctaacaatgctgc | 16 | 52.4 | 18.7±0.9 | 3 | ||
N4(-2) | (-2) | tgccaatgtgatctt | 15 | 47.9 | (-2) | gctaacaatgctgc | 14 | 47.7 | 14.7±1.0 | 2 |
N4(-4) | (-4) | ccaatgtgatctt | 13 | 38.8 | (-4) | taacaatgctgc | 12 | 38.7 | 18.8±1.6 | 1 |
N4(-6) | (-6) | aatgtgatctt | 11 | 27.5 | (-6) | acaatgctgc | 10 | 34.7 | 22.7±1.5 | 1 |
N5 | ctcccttctgcgtaga | 16 | 53.6 | acgtagtcgcaacag | 15 | 52.3 | 24.0±0.1 | 3 | ||
N5(-2) | (-2) | cccttctgcgtaga | 14 | 49.3 | (-2) | gtagtcgcaacag | 13 | 44.6 | 24.6±0.6 | 1 |
N5(-4) | (-4) | cttctgcgtaga | 12 | 39.8 | (-4) | agtcgcaacag | 11 | 39.8 | 33.1±7.9 | 1 |
N5(-6) | (-6) | tctgcgtaga | 10 | 32.2 | (-6) | tcgcaacag | 9 | 29.9 | 38.3±4.1 | 1 |
N6 | ctgcctggagttgaat | 16 | 52.3 | cctgctagaatggctg | 16 | 53.1 | 18.4±0.8 | 4 | ||
N6(-2/-) | (-2) | gcctggagttgaat | 14 | 47.3 | cctgctagaatggctg | 16 | 53.1 | 22.2±3.6 | 3 | |
N6(-/-2) | ctgcctggagttgaat | 16 | 52.3 | (-2) | tgctagaatggctg | 14 | 47.1 | 24.7±2.2 | 3 | |
N6(-2) | (-2) | gcctggagttgaat | 14 | 47.3 | (-2) | tgctagaatggctg | 14 | 47.1 | 24.1±2.0 | 2 |
N6(-4) | (-4) | ctggagttgaat | 12 | 35.9 | (-4) | ctagaatggctg | 12 | 37.3 | 19.6±1.3 | 1 |
N6(-6) | (-6) | ggagttgaat | 10 | 25.8 | (-6) | agaatggctg | 10 | 31.0 | 20.1±0.9 | 1 |
Note: LAMP assays (10 µL reaction) were performed as described in “Methods”. The DNA plasmid containing the N gene of SARS-CoV-2 was used as template (2000 cp/reaction, 3-10 replicates). In the control reaction (3-4 replicates), no template DNA was added. The TT values (Time to Threshold) were calculated from the replicated reactions and presented as mean±SD. The FP (false-positive) scores were calculated as described in Fig.1 and in the main text. For each primer set, an FP score was calculated for each control replicate, and the highest FP score from all replicates was selected and presented in the table.