Zinc oxide nanoparticles augment CD4, CD8, and GLUT‐4 expression and restrict inflammation response in streptozotocin‐induced diabetic rats

Abstract

This study evaluated the biochemical, molecular, and histopathological mechanisms involved in the hypoglycaemic effect of zinc oxide nanoparticles (ZnONPs) in experimental diabetic rats. ZnONPs were prepared by the sol–gel method and characterised by scanning and transmission electron microscopy (SEM and TEM). To explore the possible hypoglycaemic and antioxidant effect of ZnONPs, rats were grouped as follows: control group, ZnONPs treated group, diabetic group, and diabetic + ZnONPs group. Upon treatment with ZnONPs, a significant alteration in the activities of superoxide dismutase, glutathione peroxidase, and the levels of insulin, haemoglobin A1c, and the expression of cluster of differentiation 4+ (CD4+), CD8+ T cells, glucose transporter type‐4 (GLUT‐4), tumour necrosis factor, and interleukin‐6 when compared to diabetic and their control rats. ZnONPs administration to the diabetic group showed eminent blood glucose control and restoration of the biochemical profile. This raises their active role in controlling pancreas functions to improve glycaemic status as well as the inflammatory responses. Histopathological investigations showed the non‐toxic and therapeutic effect of ZnONPs on the pancreas. TEM of pancreatic tissues displayed restoration of islets of Langerhans and increased insulin‐secreting granules. This shows the therapeutic application of ZnONPs as a safe anti‐diabetic agent and to have a potential for the control of diabetes.

1 Introduction

Diabetes mellitus (DM) is a high‐blood sugar metabolic disorder. Usually, the pancreas produces some insulin. Nevertheless, either the produced amount is not sufficient for the needs of the body or the cells of the body resist it [1]. Therefore, these patients need new drugs that are used in the treatment of diabetes and have no side effects. Nowadays, nanoparticles are primarily the most important aspect of nanotechnology because of their economic and commercial significance. Recent studies have shown the role of metals in life‐threatening diseases [2, 3, 4], particularly in the metabolism of glucose and the relation of their decreased levels with the emergence of DM, such as vanadium [5], chromium [6], magnesium [7], and zinc [8].

Moreover, zinc has an important antioxidant role [8, 9], and its reduction can intensify oxidative stress‐mediated complications of diabetes. Therefore, there is a complex interrelationship between zinc, diabetes, and complications of diabetes. Studies of zinc supply in diabetic rats have included the beneficial role of zinc in diabetes [10]. It has been shown that zinc plays an essential role in the maintenance of blood sugar and is included in diabetes treatment. Zinc retains the insulin structure [11] and plays a role in biosynthesis, storage, and secretion of insulin. In pancreatic β‐cells, there are many zinc transporters [12], such as zinc transporter 8, which in turn plays a useful role in insulin secretion [13]. Besides, zinc could ameliorate the signalling of insulin through a variety of mechanisms, including increased phosphorylation of insulin receptors, promoting phosphoinositide 3‐kinase activity, and inhibition of glycogen synthase kinase‐3 [14]. There is also a relation between zinc deficiency and the progression of type 2 diabetes [10]. Reduced zinc in the pancreas can also limit the β‐cells’ ability to produce and secrete insulin [10]. In this context, zinc oxide nanoparticles (ZnONPs) are identified as a novel agent for the delivery of zinc to treat diabetes type 2. Herein, our attention was directed to assess the mechanism by which ZnONPs affected glycaemic status and antioxidant profile. Then, we explored the effects on the expression of glucose transporter type 4 (GLUT‐4), tumour necrosis factor‐α (TNF‐α), and interleukin 6 (IL‐6) in addition to the histopathological mechanisms involved in the anti‐diabetic activity of ZnONPs in diabetic rats. This all to provide evidence that will support therapeutic efforts to treat DM with ZnONPs.

2 Material and methods

2.1 Synthesis of ZnONPs

ZnONPs were synthesised according to the sol–gel method [15]. Firstly, 11.0 g zinc acetate dehydrate and 17.71 g oxalic acid (H₂ C₂ O₄) were dissolved separately in 300 and 200 ml ethanol, respectively. In the meantime, the two solutions were stirred for 1 h at 50° C and added to each other slowly. The mixture was refluxed at 50°C for one hour and left to cool down. After that, the ZnO gel was dried at 80°C for 20 h to give xerogel. Finally, the obtained xerogel was calcined under flowing air (0.1 mmol S⁻¹) for 3 h at (400, 500, and 600°C) to get crystalline nanoparticles of zinc oxide (ZnO).

2.2 Characterisation of ZnONPs

Nature and size of crystalline phases of ZnO were determined employing X‐ray diffraction (XRD), the total acidity of ZnO, the potentiometric titration method, and using an Orion 420 digital model and a double junction electrode [16]. ZnO particle sizes were examined by a Jeol JSM‐840 scanning electron microscope (SEM) under a high vacuum and acceleration voltage of 200 keV [17].

The size and shape of ZnONPs were examined using a JEM‐2100F transmission electron microscope (TEM) at a voltage of 300 keV. Transmission electron micrograph gives the size and shape distributions promptly [18].

2.3 Experimental animals

Forty‐eight male Wister albino rats with average body weight (b.w.) 120 ± 20 g were used. Rats were obtained from the Holding Company for Biological Products and Vaccines (VACSERA, Cairo, Egypt). The rats were housed in separate metal cages, fresh and clean drinking water was supplied ad libitum. Rats were kept at appropriate environmental and nutritional conditions during the duration of the experiment. Rats were left seven days for adaptation before the beginning of the experiment. All experiments were performed in agreement with the regulations of ‘the Institutional Animal Ethics Committee of Mansoura University, Mansoura, Egypt’, which are in accordance with the ‘Guide for the Care and Use of Laboratory Animals published by ‘the National Academy of Sciences’.

2.4 Diabetes induction

DM was induced by an intra‐peritoneal injection of streptozotocin (STZ; 45 mg/kg) (Sigma Chemical Co., USA) freshly dissolved in citrate buffer (0.1 M, pH 4.5) [19]. Blood glucose level was monitored every three days by a PRECICHEK™ blood glucose meter (Fia Biomed GmbH, Germany). Animals exhibited high‐blood sugar levels ˃250 mg/dl) were selected and assembled (n  = 6), uniformly distributed.

2.5 Animal grouping

One week after diabetes induction, the diabetic rats were randomly subdivided into four groups, six animals each. Rats were placed in individual cages as follows: control; healthy rats treated with 1 ml saline solution, ZnONPs treated group; healthy rats received an oral daily dose of ZnONPs (10 mg/kg), diabetic; received a single intra‐peritoneal dose of STZ (45 mg/kg), diabetic + ZnONPs; and diabetic rats received a single daily oral dose of (10 mg/kg) ZnONPs. After 30 days of daily administration of ZnONPs, overnight fasting animals were sacrificed under isoflurane anaesthesia. Blood samples were collected for the determination of blood glucose and insulin. Liver tissues were collected and homogenised for antioxidants [superoxide dismutase (SOD) and glutathione peroxidase (GPx)] activities. Liver and kidney tissues were taken on RNA later until the isolation of RNA, for molecular investigations. Then, as a follow‐up study, the rest of the rats (24 rats) were kept for another month of daily administration. Overnight fasting animals were sacrificed. Pancreas tissues from each group of animals were checked by light microscopic examination and TEM.

2.6 Tissue homogenate preparation

A known weight of liver tissue from each rat was homogenised in 5 ml of ice‐cold saline, centrifuged at 4000 rpm for 20 min at 4°C to remove cell debris and nuclei.

2.7 Biochemical investigation

Blood glucose (mg/dl) was determined [20] using the kit supplied by SPINREACT (Spain). Serum insulin was determined using an insulin Elisa kit supplied by Bioassay Technology Laboratory (Catalogue No. E0707Ra). Blood glycosylated haemoglobin level was determined using the kit supplied by Spectrum (Catalogue No. 602001, Egypt). SOD activity was estimated according to the method described by Nishikimi et al. [21] using a kit supplied by Biodiagnostic (Catalogue No. SD 2521, Egypt). The activity of GPx was determined according to the method proposed in [22] using a kit supplied by Biodiagnostic (Catalogue No. GP 2524, Egypt).

2.8 Real‐time quantitative reverse transcription polymerase chain reaction (qRT‐PCR) analysis

Total RNA of liver and kidney tissues was isolated using TRizol™ Reagent technique (cat no. 15596026; Invitrogen). Complementary DNA (cDNA) synthesis was undertaken using 2X RT Master Mix kit (Archive, High Capacity cDNA RT Kit) with 1 μl total RNA and random primers. The cDNA samples were run in triplicate for real‐time polymerase chain reaction (PCR) analysis. Glyceraldehyde 3‐phosphate dehydrogenase (GAPDH) (forward: AGACAGCCGCATCTTCTTGT; reverse: TTCCCATTCTCAGCCTTGAC) was used as the housekeeping gene. Real‐time PCRs were performed using a Thermo Scientific Maxima SYBR Green qPCR Master Mix (2×). Then, qRT‐PCR was performed as follows: initial denaturation at 95°C for 10 min, denaturation at 95°C for 15 s, annealing for 30 s, and extension at 72°C for 30 s with 40 repeated thermal cycles measuring the green fluorescence at the end of each extension step. The transcript levels of target genes were calculated using the comparative method (2−^ΔΔC t) [23]. Results were normalised to the housekeeping gene GAPDH. The PCR primers for the following genes were GLUT‐4 (forward: CCCCCGATACCTCTACAT; Reverse: GCATCAGACACATCAGCCCAG), TNF‐α (forward: TACTGAACTTCGGGGTGATTGGTCC; reverse: CAGCCTTGTCCCTTGAAGAGAACC) and IL‐6 (forward: GCCCTTCAGGAACAGCTATGA; reverse: TGTCAACAACATCAGTCCCAAGA).

2.9 Labelling of cells and flow cytometric analysis

For detecting cells, a single staining technique was performed using rat anti‐CD4 (Cat no. 300505) and rat anti‐CD8 (Cat no.555366) (BD Pharmingen, USA). The labelling procedure was according to the BD Pharmingen manual. Then 10 µl from 1×10⁶ cell suspension (whole blood) were collected from the studied groups and added to the recommended antibody according to the method proposed in [24]. The samples were placed in a FACS Calibur system (BD, Sunnyvale, CA, USA).

2.10 Histological investigation

For histological preparations, specimens from the pancreas were collected. They were fixed in 10% neutral buffered formalin for 24 h after being washed in saline solution. Using the ascending series of ethanol, samples were dehydrated, and xylene was utilised for the clearing process. Samples were then mounted at 58–62°C molten paraplast. Afterwards, prepared blocks were cut into 4–5 μm slices and stained with haematoxylin and eosin and then examined microscopically [25].

2.11 Transmission electron microscopy

Pancreas samples were fixed in 2.5% buffered glutaraldehyde mixed with 2% paraformaldehyde in 0.1 M sodium phosphate buffer, pH 7.4. Subsequently, samples were washed, post‐fixed in sodium phosphate‐buffered osmium tetroxide, then washed and dehydrated in ascending series of ethanol. Subsequently, samples were processed for the Epon moulding technique. Semi‐thin sections were stained with toluidine blue stain, and then ultrathin sections were stained with uranyl acetate and lead citrate [26]. Sections were examined at 160 kV using a JEOL JEM‐2100 at EM Unit, Mansoura University, Egypt.

2.12 Statistical analysis

Data analysis was performed using SPSS software ver20 (SPSS Inc., Chicago). All results were represented as means ± SEM. Statistical analysis was performed by analysis of variance with least significant difference and post hoc.

3 Results

3.1 XRD analysis of ZnONPs

The XRD patterns of ZnONPs are shown in Fig. 1. The sharp and intense peaks indicate that the ZnO sample is highly crystalline. All of the indexed peaks indicate that the sample is the typical wurtzite hexagonal structure (JCPDS card No. 36‐1451) [16].

Fig. 1.

XRD pattern of ZnO

3.2 SEM of ZnONPs

The surface morphology of the prepared sample was examined by SEM. It is displayed that particles, to some extent, are aggregated, and have an irregular spherical shape with a particle size ranging between 90 and 150 nm (Fig. 2).

Fig. 2.

SEM analysis of ZnONPs

3.3 TEM analysis of ZnONPs

Fig. 3 illustrates that ZnONPs are almost hexagonal (spherical) in shape and are agglomerated up to some extent. The average nanoparticle diameter measured of ZnO is ˂25 nm, as shown in Fig. 3.

Fig. 3.

TEM of ZnO

3.4 Acidity test

The surface acidity of the ZnO was determined by non‐aqueous titration of n ‐butyl amine (pK _a  = 10.73), which is a basic molecule suitable for titrating the medium and strong acid sites on the surface of the ZnO. Fig. 4 illustrates the variation of the electrode potential for ZnO calcined at 500°C with volume added from n ‐butylamine. This figure shows that as the acid sites of the solid become neutralised, a buffer behaviour becomes more apparent. The trend of the titration curve is asymptotic, leading to a characteristic value of the potential (mV) axis [16]. This is related to the volume added from n ‐butyl amine/g needed for neutralisation of the surface acidity. The magnitude of the change of the electrode potential is related to the surface acidity of the catalyst. It was found that 0.35 ml added from n ‐butyl amine/g showed 2.1 × 10¹⁹ total number of acid sites/g.

Fig. 4.

Acidity curve of ZnO

3.5 Biochemical effect of ZnONPs intake on glucose levels in normal and diabetic rats

Table 1 shows the fasting blood glucose levels in all groups after four weeks of treatment. There was no significant change in the mean serum level of glucose in control rats treated with ZnONPs (10 mg/kg b.w.) compared with the normal control group (p ˃0.05). While there was an extremely significant increase in fasting blood glucose levels in STZ‐diabetic rats when compared with normal control rats. In contrast, a significant reduction in the blood glucose level is observed in STZ diabetic rats‐treated with ZnONPs (10 mg/kg b.w.) compared with the STZ‐diabetic group.

Table 1.

Effect of ZnONPs intake on blood glucose, glycosylated HbA1C and serum insulin of normal and STZ‐diabetic rats

	Normal control	Control treated with ZnONPs, 10 mg/kg b.w.	Diabetic control	Diabetic treated with ZnONPs, 10 mg/kg b.w.
fasting blood glucose, mg/dl	116.22 ±4.0	93.42 ± 4.65NS	469.95 ± 48.51a	94.76 ± 7.21b
glycosylated haemoglobin, %	5.45 ± 0.13	5.25 ± 0.17NS	8.78 ± 0.47a	6.34 ± 0.32b
serum insulin	27.50 ± 1.70	28.60 ± 2.36NS	16.74 ± 2.28a	25.63 ± 2.07b

The results for six rats in each group are expressed as mean±SEM.

^a Highly significant in comparison with normal control groups.

^b Highly significant in comparison with diabetic control groups; NS, not significant.

In the STZ‐diabetic untreated group, glycosylated haemoglobin A1c (HbA1c) level was significantly increased when compared with the normal control group. While the diabetic rats treated with ZnONPs (10 mg/kg b.w.) showed a significant reduction in glycosylated haemoglobin levels when compared with the diabetic control group (Table 1). While there was no significant change in the mean value of blood HbA1c level in control‐treated with ZnONPs when compared with the normal control group.

There was no significant change in the mean serum level of insulin in control‐treated with ZnONPs (10 mg/kg b.w./day) when compared with the normal control group. There was a highly significant increase in the mean serum level of insulin observed in STZ‐treated rats with ZnONPs (10 mg/kg b.w./day) compared to the diabetic control group (Table 1).

Table 2 represents SOD and GPx activity in the liver of various groups. There were no significant changes in the contents of SOD and GPx of the normal group treated with ZnONPs (10 mg/kg b.w.) compared with the normal control group. However, the hepatic contents of SOD and GPx in the STZ‐diabetic group were significantly decreased while there was a significant increase in the content of hepatic SOD and GPx in the diabetic group treated with ZnONPs (10 mg/kg b.w.) when compared with the diabetic control group.

Table 2.

Effect of ZnONPs intake on SOD activity and GPx activity in the liver of normal and STZ‐diabetic rats

Parameter	Groups
	Normal control	Control treated with ZnONPs, 10 mg/kg b.w.	Diabetic control	Diabetic treated with ZnONPs, 10 mg/kg b.w.
SOD, U/g tissue	176.14 ± 10.81	200.51 ± 11.73NS	128.91 ± 6.08a	173.38 ± 8.35b
GPx, mmol/g tissue	100.31 ± 3.06	99.41 ± 2.87NS	58.36 ± 7.10a	90.63 ± 7.28b

The results for six rats in each group are expressed as mean±SEM.

^a Highly significant in comparison with normal control groups.

^b Highly significant in comparison with diabetic control groups; NS, not significant.

To determine whether ZnONPs regulate the glucose transporter and inflammatory cytokines in diabetic rats, we determined the expression of GLUT‐4 and inflammatory cytokines IL‐6 and TNF‐α. Table 3 represents the messenger RNA (mRNA) expression profile of (GLUT‐4, TNF‐α, and IL‐6) genes in different groups’ liver and pancreas tissue. There were no significant changes in expression of GLUT‐4, TNF‐α, and IL‐6 in the normal group treated with ZnONPs (10 mg/kg b.w.) compared with the normal control group. However, the expression of GLUT‐4 was significantly decreased in the STZ‐diabetic group, while there was a significant decrease in the expression of TNF‐α and IL‐6 in the diabetic group treated with ZnONPs (10 mg/kg b.w.) when compared with the diabetic control group.

Table 3.

Effect of ZnONPs on the mRNA expression profile (a fold of change relative to the control group) of GLUT‐4, TNF‐α, and IL‐6 genes in STZ‐induced diabetic rats

Group genes	Normal control	Control treated with ZnONPs, 10 mg/kg b.w.	Diabetic control	Diabetic treated with ZnONPs, 10 mg/kg b.w.
GLUT‐4	0.80 ± 0.021	0.82 ± 0.026 NS	0.123 ± 0.003a	0.523 ± 0.0708b
TNF‐α	0.98 ± 0.043	0.96 ± 0.033 NS	5.17 ± 0.317a	2.12±.0048b
IL‐6	1.35 ± 0.015	1.32 ± 0.006 NS	5.43 ± 0.067a	2.91 ± 0.051b

The results for six rats in each group are expressed as mean±SEM.

^a Highly significant in comparison with normal control groups.

^b Highly significant in comparison with diabetic control groups; NS, not significant.

CD4 and CD8 markers investigations were carried out in all groups. Data in Figs. 5 and 6 indicated that ZnONPs and STZ + ZnONPs treated groups were significant (p ˂0.05) correlated to STZ (diabetic) group and consequently had a lower percentage than the STZ injected group. Values for CD4 were expressed as means ± SEM (17.43%±0.22), (20.83%±1.30), (59.73%±1.12) and (21.37 ± 1.03), respectively. While there was no significant correlation between ZnONPs treated group and control healthy groups. For values of CD8, (17.37 ± 0.92), (22.27 ± 1.39), (44.27 ± 2.31), and (27.4 ± 0.79), respectively. ZnONPs and STZ + ZnONPs treated groups were significant with (p ˂0.05) correlated to STZ treated group (44.27 ± 2.31), which was significantly elevated when compared to that of control (17.37 ± 0.92) and STZ + ZnONPs groups (27.4 ± 0.79). In brief, the STZ‐treated group within both markers presented high values compared to control animals, and conversely, STZ + ZnONPs exhibited remarkable recovery presented by low values around that of control animals.

Fig. 5.

Flow cytometric histogram

(a) , (b) Expression of CD4 extracted from the total count of pancreas cells stained with Fluorescein isothiocyanate (FITC)‐conjugated CD4

Fig. 6.

Flow cytometric histogram

(a) , (b) Expression of CD8 extracted from the total count of pancreas cells stained with Phycoerythrin (PE)‐conjugated CD8

3.6 Effect of ZnONPs intake on histomorphologic changes of pancreatic tissue in diabetic animals

Microscopic investigation of normal control pancreas samples showed the classic structure of both exocrine (acini or lobules) and endocrine portions such as islets of Langerhans that are dispersed in between pancreatic lobules. Islets of Langerhans were stained lighter than the surrounding acini. Islets’ borders were distinct and noticed. Each islet is made up of groups of cells of polygonal configuration that are separated from the blood capillaries network. Hence, the whole construction was ordinary and healthy, as illustrated in Fig. 7 a. ZnONPs oral inoculated animals’ pancreas exhibited almost the same normal structure as that of the previous group (Fig. 7 b).

Fig. 7.

Photomicrograph of pancreatic tissue of rats in different groups

(a) , (b) Control and ZnONPs treated groups (10 mg/kg b.w) respectively showing the normal structure of islets of Langerhans (IL), acinar cells (AC), β‐cell (βC), and islets boundaries (white arrows), (c) STZ treated group showing atrophied islets (IL), vacuolated cells (arrowheads), and lymphocytic infiltration (black arrows), (d) STZ + ZnONPs treated rats (10 mg/kg b.w) displayed restoration of the normal islet of Langerhans (IL), and AC (X 400)

Unlike the preceding groups, STZ (45 mg/kg b.w./day) injected animals displayed severe damage represented by shrinkage of islets’ sizes, evident structural disarrangement along with the lack of some islets’ cells (Fig. 7 c). Significant degenerations were located. In addition to the previous damage, boundaries between islets and acini were indistinguishable. Some foci showed cytoplasmic vacuolations. Besides, certain spots revealed lymphocytic infiltration (Fig. 7 c). The diabetic group treated with ZnONPs (10 mg/kg b.w./day) for 4 weeks indicated noticeable improvement when compared to the former diabetic group. This improvement was characterised by expansion in islets’ size and the rare appearance of lymphocytic infiltration and recovery of most of the cellular constructions.

Furthermore, boundaries amongst islets and acini became somehow notable. Moreover, there was an apparent rise in cell count accompanied by a drop in lymphocytic infiltration (Fig. 7 d). These findings strongly recommend the promising therapeutic impact for such a nano‐formulated compound.

3.7 Electron microscopic investigation

Ultrastructural examination of the control pancreas tissue revealed an ordinary structure of pancreatic islets and appeared lighter than the nearby α or δ cells. Nucleus appeared normal with dispersed euchromatin. Moreover, evident endoplasmic reticulum, a reasonable number of mitochondria, and plentiful of electron‐dense secretory granules enclosed with electron‐lucent halo are shown in Fig. 8 a. Electron microscopic investigation of ZnONPs treated rats presented the same typical configuration like that of controls one as displayed in Fig. 8 b.

Fig. 8.

TEM of pancreatic tissues for different groups displaying islets of Langerhans

(a) , (b) Control and ZnONPs treated groups, respectively, β‐cell (βC), α‐cell (αC), nucleus (N), nucleolus (Nu), secretory granules (SG), and arrowheads (mitochondria), (c) STZ treated group showing excessive numbers of mitochondria (arrowheads), dilated endoplasmic reticulum (arrows), and vacuolated cytoplasm (*), (d) STZ + ZnONPs treated rats displayed almost normal structures like that of the control group

Conversely, diabetic rats displayed moderate degenerations, probably due to small‐injected dose to animals. Those injuries were illustrated in evident asymmetrical nuclei's boundaries, flatulent secretory granules of insulin, and dilated endoplasmic reticulum that occasionally was wrapping an enormous amount of mitochondria. Vacuolated cytoplasm was evident in some foci, as displayed in Fig. 8 c.

On the contrary, ZnONPs treated diabetic rats exhibited marked restoration of the normal structure of β‐cells that were characterised by the occurrence of intact nuclei with symmetrical boundaries and moderate count of mitochondria.

Furthermore, most of the insulin secretory granules were filled with insulin. There was a noticeable absence of dilated endoplasmic reticulum and vacuolated cytoplasm as shown in Fig. 8 d.

4 Discussion

DM is a metabolic disease characterised by high‐blood glucose levels and causes severe damage to many of the body's systems. Therefore, it is considered as a severe threat to humanity [27]. Insulin injection and oral hypoglycaemic agents are different options for the treatment of DM. Nevertheless, these agents have some adverse side effects, e.g. hypoglycaemia, weight gain, and liver toxicity. Nowadays, nanoparticles are primarily the most important aspect of nanotechnology that have shown an essential role in life‐threatening diseases [2, 3, 4], particularly in the metabolism of glucose [28, 29, 30].

The intra‐peritoneal administration of STZ selectively destroys pancreatic β‐cells [31] via GLUT‐2 transporter and alkylating their DNA, which in turn leads to apoptosis, causes severe insulitis, and thus type 2 DM [32]. Several metals nanoparticles are used as a means of drug delivery systems. The metals nanoparticles, such as zinc, silver, iron, and gold, oxides of nanoparticles have an essential role in medical and biological applications [33]. It was reported that ZnO could be classified as a multifunctional substance due to its diverse characteristics that paved the way for the expansion of its application [34]. ZnONPs could be recognised as one of the eminent nanoparticles metal oxide owing to their exotic chemical and physical characteristics [35]. The present study aimed to investigate the anti‐diabetic activity of ZnONPs in STZ‐diabetic rats.

In this work, sharp and intense peaks of the prepared ZnO were obtained, which indicates the good state of the obtained crystalline ZnO sample. All of the indexed peaks indicate that the sample is the typical wurtzite hexagonal structure (JCPDS card no. 36‐1451) [16]. The difference in the particle sizes shown by XRD analysis and SEM for ZnO could be due to particle gathering [36]. Besides, the SEM measurements are based on the difference between the visible grain boundaries, while XRD calculations measure the extended crystalline region that coherently converts X‐rays. Thus, the XRD method has a more compact standard and leads to smaller sizes [17].

Concerning ZnONPs and glucose homeostasis, our results pointed out that blood glucose levels were improved in diabetic rats‐treated with ZnONPs. HbA1c is a metabolic control indicator for DM [37]. In this work, we found that the level of HbA1c had increased significantly in STZ‐diabetic rats compared to treatment groups that were inconsistent with other findings in the same line [38]. This proved the hypoglycaemic effect of ZnONPs by decreasing the blood glucose, thus decreasing the amount of glycosylated haemoglobin.

Insulin is produced and stored in the secretory granules of the pancreatic p‐cells, from where it is continually secreted into the pond circulation. It regulates peripheral glucose uptake and glucose production within the liver [39]. Our study revealed that the serum insulin level in diabetic groups treated with ZnONPs increased significantly, but the serum insulin level in the diabetic control group decreased significantly. This proves that ZnONPs induced the β‐cells to secrete insulin. Interestingly, in living organisms, ZnONPs had no risk of hypoglycaemia so that it could act as an inducer and modulator of insulin secretion. An increased level of serum insulin in diabetic groups treated with ZnONPs may also be caused by the accumulation of zinc in the β‐cell secretory vesicle using transporter 8 [10, 12]. Zinc transporters are also known as the key regulator of glucose metabolism in adipose tissues and liver [40]. Previous studies showed that reduced zinc in the pancreas could reduce the islet β‐cells’ ability to produce and secrete insulin and may also affect the development of Type 2 DM [41].

Persistent oxidative stress causes the pathogenesis of chronic diseases, including DM [8]. During diabetes, continuous hyperglycaemia leads to free radical development, primarily reactive oxygen species (ROS) [42]. Our results pointed out that SOD in the STZ‐diabetic group was significantly reduced compared to the normal control group due to the increased ROS levels in diabetes. The decreased SOD level in diabetic rats referred to its consumption in the process of converting superoxide anions into hydrogen peroxide to protect the cell from the destructive effect of superoxide anions. Furthermore, this decrease may be due to the increase of glycosylated SOD, which causes the inactivation of this enzyme [43].

On the other hand, the hepatic SOD content of STZ‐diabetic rats treated with ZnONPs (10 mg/kg b.w.) has significantly increased when compared with the STZ‐diabetic group. This was due to the fact that zinc is a functional component of essential antioxidant enzymes such as SOD. Zinc deficiency hinders their synthesis, leading to increased oxidative stress [44]. Additionally, there was a significant decrease in the activity of GPx enzyme in STZ‐diabetic rats compared to the healthy control rats. While it was significantly increased after the treatment of ZnONPs (10 mg/kg b.w.), the decreased activity of GPx in diabetic rats may be due to the decreased SOD activity required to scavenge superoxide radicals. Decreased SOD activity causes higher rates of superoxide radicals resulting in GPx inhibition [45]. These observations are consistent with previous studies [46].

GLUT transmembrane proteins transport glucose across the cell membrane. In skeletal muscle and adipose tissue, glucose uptake occurs via insulin‐stimulated transport that mediated glucose transporter type‐4 (GLUT‐4). GLUT‐4 is a principal factor in glucose homeostasis and glucose uptake [47, 48]. In our study, pancreatic GLUT‐4 mRNA expression is reduced in STZ‐diabetic rats compared to the control‐healthy rats. While after treatment with ZnONPs for four weeks, the GLUT‐4 mRNA expression is increased. This shows the potential role of ZnONPs on the expression of transmembrane proteins.

Proinflammatory cytokines have an essential effect on the management of the pathological processes of diabetes [49]. We detected the expression levels of TNF‐α and IL‐6 among the experimental groups. IL‐6 has been identified as a factor responsible for insulin resistance; also, it has been related to the incidence of type 2 diabetes. Previous studies showed the elevated levels of circulating IL‐ 6 in type 2 diabetes [50, 51]. Our current data proposed that ZnONPs restricted the production of the IL‐6 in diabetic rats. However, the mRNA expression level of TNF‐α in liver tissue was significantly increased in the diabetic rats, but oral administration of ZnONPs significantly reduced the level of TNF‐α compared to diabetic rats. These findings are consistent with investigators who explored other compounds that could inhibit the expression of TNF‐α and IL‐6 to suppress the up‐regulation of inflammatory mediators [52].

Previous studies suggested that there is a relationship between DM and immune suppression [53]. We examined the influence of ZnONPs administration on the levels of CD4+ T cells and CD8+ T cells within the pancreatic tissues. Our findings showed upstream of CD4+ T cells within the pancreatic cells of the diabetic group. Concerning CD8+ cytotoxic T cells, there was a remarkable increase in count compared to the control group, but less than that occurred with CD4+ T helper cells. This reflects that CD4+ T helper cells are more liable to extrinsic factors than CD8+ cytotoxic T cells that give rise to β‐cell devastation, our findings are close to that of previous investigations [54, 55].

Histopathological investigations showed that ZnONPs induced noticeable improvement in the structure of islets of Langerhans. This improvement and the non‐toxic and therapeutic effect of ZnONPs on the pancreas support the biochemical findings. TEM of pancreatic tissues displayed restoration of islets of Langerhans and increased insulin‐secreting granules. This explains the increased serum insulin level in the diabetic group upon treatment with ZnONPs.

5 Conclusion

The present study indicates that upon ZnONPs treatment of diabetic rats, there was a significant improvement in the biochemical markers, blood glucose, glycosylated HbA1c and serum insulin, and the activities of antioxidant enzymes; SOD and GPx. ZnONPs restricted the production of TNF‐α and IL‐6 in the diabetic rats and augmented the expression of GLUT‐4, CD4+, and CD8+ T cells. This may suggest a powerful influence of ZnONPs against STZ action, whereas ZnONPs showed a significant role in the restoration of β‐cells structure and number. Such findings warrant a further therapeutic investigation into ZnONPs production as a safe anti‐diabetic agent and to have a potential for the control of diabetes.