Bio‐green synthesis ZnO‐NPs in Brassica napus pollen extract: biosynthesis, antioxidant, cytotoxicity and pro‐apoptotic properties

Abstract

The bio‐green methods of synthesis nanoparticles (NPs) have advantages over chemo‐physical procedures due to cost‐effective and ecofriendly products. The goal of current investigation is biosynthesis of zinc oxide NPs (ZnO‐NPs) and evaluation of their biological assessment. Water extract of Brassica napus pollen [rapeseed (RP)] prepared and used for the synthesis of ZnO‐NPs and synthesised ZnO‐NP characterised using ultraviolet–visible, X‐ray diffraction, Fourier‐transform infrared spectroscopy, field emission scanning electron microscope and transmission electron microscope. Antioxidant properties of ZnO‐NPs, cytotoxic and pro‐apoptotic potentials of NPs were also evaluated. The results showed that ZnO‐NPs have a hexagonal shape with 26 nm size. ZnO‐NPs synthesised in RP (RP/ZnO‐NPs) exhibited the good antioxidant potential compared with the butylated hydroxyanisole as a positive control. These NPs showed the cytotoxic effects against breast cancer cells (M.D. Anderson‐Metastasis Breast cancer (MDA‐MB)) with IC₅₀ about 1, 6 and 6 μg/ml after 24, 48 and 72 h of exposure, respectively. RP/ZnO‐NPs were found effective in increasing the expression of catalase enzyme, the enzyme involved in antioxidants properties of the cells. Bio‐green synthesised RP/ZnO‐NPs showed antioxidant and cytotoxic properties. The results of the present study support the advantages of using the bio‐green procedure for the synthesis of NPs as an antioxidant and as anti‐cancer agents.

1 Introduction

Rapeseed (RP), Brassica napus, belongs to the Brassicaceae family, cultivated mainly for its oil‐rich seed [1]. B. napus is used both for oil crop and for its nectar [2]. B. napus has comparatively long flowering time (four weeks), each plant can produce more than 100 flowers that these flowers can be used to produce and collect nectar [3]. In addition, nectar from B. napus contains high amounts of sugar with good quality [4]. Owing to the special ingredients such as 3‐phenylpropionic acid and phenyl acetic acids, the odour of RP nectar is appealing to bees [4]. The pollen that is collected by the bees has a therapeutic effect and can be used as a natural food with therapeutic effects in order to strengthen the immune system [5]. According to the research, steroids isolated from pollen have an influence on the viability of the human cancer cells such as prostate cancer [1]. Therefore, the use of B. napus pollen for the treatment of advanced prostate cancer is the basis for future research. However, the exact chemical components of the pollen should be identified first, and the pharmacological mechanisms underlying anti‐cancer effect should be clarified. Zinc oxide nanoparticles (ZnO‐NPs) are a hopeful platform for use in the pharmacological investigation [6]. The biomedical activities are related to the capacity of ZnO‐NPs to produce reactive oxygen species (ROS) and induce apoptosis [7]. In addition, ZnO‐NPs have been successfully synthesised by several chemical, mechanical and bio‐green methods [8]. In bio‐green methods, plant and microorganism biomass are used for biosynthesis of these NPs [9]. Producing NPs through plants is a simple and favourable method, which does not require any remarkable, complicated and multi‐step technique [10]. The reductive qualities of plant extract were exploited in order to synthesise metal NPs, and related to many functional groups such as –NH₂, –OH, C=O, C–O–C, C–N–C and –S–S–, which let the contribution of electrons to make metal NPs formation [10, 11] (Fig. 1).

Fig. 1.

Structural formula of phenylacetic acid

During normal cellular metabolisms such as respiration and photosynthesis, ROSs are produced and scavenged by antioxidant defence systems of the organisms [12]. Under different stress conditions, the rate of ROS production overrides the rate of ROS removal, leading to oxidative stress in the organisms [13]. Oxidative stress generated by ROS damages macromolecules such as proteins, lipids and nucleic acids and often leads to metabolic dysfunction and programmed cell death [14, 15].

The aim of this research is to synthesise ZnO‐NPs using B. napus pollen which contains phenyl acetic acid. Phenyl acetic acid is an organic compound containing a phenyl functional group and a carboxylic acid functional group. These functional groups act as reducing and stabilising agent in synthesis of RP/ZnO‐NPs [16]. In second part of this research, the antioxidant activity of RP/ZnO‐NPs and cytotoxicity and pro‐apoptotic activities evaluated.

2 Materials and methods

2.1 Reagents and media

Zinc acetate dihydrate (Zn(CH3COO)₂ _2H₂ O((99%) (Merck) was of analytical grade which was used as a metal ion precursor to synthesise ZnO‐NPs purchased from Sigma‐Aldrich (St. Louis, MO). Acridine orange (AO) was obtained from Sigma‐Aldrich (St. Louis, MO). Dulbecco's modified eagle medium (DMEM) (Gibco) supplemented with 10% foetal bovine serum (FBS, heat inactivated, Gibco) and 100 units/ml penicillin streptomycin (Sigma) was used as culture medium. MDA‐MB‐231 cells line was obtained from the Pasteur Institute of Iran (Tehran, Iran). 3‐(4, 5‐dimethylthiazol‐2‐yl)‐2, 5‐diphenyltetrazolium bromide (MTT) were provided from Sigma‐Aldrich (St. Louis, MO). The RNA extraction kits were provided from Roche (Mannheim, Germany) and cDNA synthesis and SYBR green kit from Fermentas Inc (company).

2.2 RP/ZnO‐NPs synthesis and characterisation

The B. napus pollen extract (10 g) suspended in 100 ml of distilled water and filtered using whatman filter paper (Fig. 2). Then, z inc acetate dihydrate (0.5 mM) mixed with 1 ml RP water extract. The mixture stirred for 2 h at room temperature and then was left in room temperature until the formation of a pale white precipitate.

Fig. 2.

Schematic of biosynthesis of ZnO‐NPs by Brassica napus pollen extract

2.3 Characterisation methods

The ultraviolet–visible (UV–vis) spectroscopy is used to measure at the range of 300–700 nm. The RP/ZnO‐NPs were also characterised using transmission electron microscope (TEM), field emission scanning electron microscope (FESEM), X‐ray diffraction (XRD) and Fourier‐transform infrared spectroscopy (FTIR). The size and size distribution of ZnO‐NPs were examined using TEM. The surface morphology of synthesised ZnO‐NPs was evaluated using FESEM. In addition, FTIR was used to examine the conjugation of pollen extract with ZnO‐NPs (Perkin Elmer, Walthman, MA, USA). To remove the non‐binding pollen, the synthesised RP/ZnO‐NPs were centrifuged at 8000 rpm for 30 min, washed with distilled water and dried. FTIR spectra for RP/ZnO‐NPs and pollen were separately recorded at a wavelength of 400–4000 nm and the two spectra were compared. The synthesised RP/ZnO‐NPs were centrifuged at 9000 rpm for 30 min and placed on carbon film for XRD analysis (X Ray Diffraction (GNR), explorer).

2.4 Cell culture and treatment

MDA‐MB‐231 breast adenocarcinoma and normal human skin fibroblast cells were cultured in DMEM, with 10% FBS and were incubated at 37°C in 5% humidified carbon dioxide. Normal human skin fibroblast cells were chosen as normal cells to compare cytotoxicity of RP/ZnO‐NPs on normal cells versus MDA‐MB‐231 cancerous cells.

2.5 Cytotoxicity effects and apoptosis induction

2.5.1 Cytotoxicity effects

MDA‐MB‐231 and normal human skin fibroblast cells were seeded into 96‐well cultured plates (5 × 10⁴ cells per well) and after overnight incubation were treated with 0–50 µg/ml concentrations of RP/ZnO‐NPs for a different time. At the end of the incubations, MTT assay was performed and absorbance was recorded at 570 nm. The viability of cells was measured using the following equation:

$$\mathrm{cell}\mathrm{viability}\left(\text{\%}\right)=\left(\mathrm{OD}\mathrm{sample}/\mathrm{OD}\mathrm{control}\right)\times 100.$$

2.5.2 AO and propodium iodide (PI) double staining for determining the type of cell death

The apoptosis induction in MDA‐MB‐231 cells which were treated with RP/ZnO‐NPs was determined by AO/PI staining. The cells were treated with different concentrations of RP/ZnO‐NPs (0, 6, 12 µg/ml) for 48 h. Then, the cell sediments were washed and mixed with the fluorescent dye (1:1) and detected by fluorescence microscope.

2.5.3 Flow cytometry for cell cycle analysis

The MDA‐MB‐231 cells were seeded and exposed with various concentrations of RP/ZnO‐NPs (3, 6 µg/ml) for cell cycle analysis. For this purpose, after washing the cells with phosphate‐buffered saline, they were combined with a PI working solution and were incubated in the dark (30 min at 37°C). FACScan laser flow cytometer (FACSCalibur, Becton Dickinson, USA) was used for cell cycle analysis.

2.6 Gene expression assay

Catalase (CAT) gene expression was examined with real‐time quantitative polymerase chain reaction (RT qPCR). At the first, RNA extraction was done from cancerous cells that have been treated with RP/ZnO‐NPs (3 and 6 µg/ml), for 24, 48, 72 and 96 h. The mRNA was reverse transcribed into cDNA with the advantage of RT qPCR kit. The cDNA was amplified using an RT instrument and Synergy Brands (SYBR) green kit. Table 1 shows the sequence of used primers in this paper.

Table 1.

Primer sequences

Gene	Forward	Reverse
GAPDH	GCAGGGGGGAGCCAAAACGGT	TGGGTGGCAGTGATGGCATGG
CAT	CGTGCTGAATGAGGAACAGA	AGTCAGGGTGGACCTCAGTG

GAPDH: glyceraldehyde 3‐phosphate dehydrogenase and CAT: catalase.

2.7 2,2‐Diphenyl‐1‐picrylhydrazyl (DPPH) assay

The free radicals inhibitory effects of NPs were estimated through its capacity to scavenge the DPPH free radicals. Various concentrations of RP/ZnO‐NPs were added to DPPH working solution (0.1 mM methanolic DPPH) with equal volume. Then, incubated for 30 min at 37°C, and finally the absorbance of the sample was recorded at 517 nm. Butylated hydroxyanisole (BHA) was used as a standard.

2.8 2,2′‐Azino‐bis(3‐ethylbenzothiazoline‐6‐sulphonic acid (ABTS) radical scavenging assay

ABTS free radicals were prepared for this assay. For this purpose, the solution of ABTS (7 mM) and potassium persulphate (2.45 mM) were combined and incubated for 12–16 h in the dark room. To obtain the ABTS⁺ working solution, the resulting solution was diluted with distilled water. The reaction mixture was obtained by mixing an equal volume of various concentrations of RP/ZnO‐NPs with ABTS⁺ working solution. After incubation time, the absorbance of the solution was recorded at 734 nm.

3 Results

3.1 Synthesis of ZnO‐NPs using RP water extract

Fig. 2 a shows the pollen extract powder and Fig. 2 b shows the colour change by visual observation in the RP water extract after formation of ZnO‐NPs. The change in the colour of the solution containing the NP may be due to excitation of free electrons in ZnO‐NPs synthesised by bioactive compounds such as phenylacetic acid present in plant extract which these compounds play important role in stabilisation of ZnO‐NPs [16].

3.2 UV–vis spectral analysis

The RP/ZnO‐NPs absorbance peak was detected by UV–vis spectrophotometer at 300 nm (Fig. 3). The red line corresponds to the zinc acetate dispersion in RP water extract, in which the peak in 300 nm indicated the formation of ZnO‐NPs. The absorption rate is also an important criterion for the presence of NPs in the solution. The higher adsorption rate indicates the presence of more NP formation in the dispersion. Manokari et al. [17] reported that the formation of ZnO‐NPs depended on the rate of the reaction functional groups present in bioactive compounds in the plant and the stability of the NPs on the reaction time.

Fig. 3.

UV–vis spectra of the RP/ZnO‐NPs. The red line is the dispersion of zinc acetate in RP water extract. The peak indicates the formation of NPs

3.3 TEM analysis

The TEM image showed that average particles size is 26 nm (Fig. 4). The radius calculated of the formed NPs reveal that the frequency peak comes at ∼10–30 nm. Dark shadows on the surface of the NPs in the TEM image may be the bioorganic molecules of RP water extract.

Fig. 4.

TEM micrograph of RP/ZnO‐NPs

3.4 FESEM analysis

FESEM image of RP/ZnO‐NPs is shown in Fig. 5. The observation on structure of the particles demonstrates that morphology of ZnO‐NPs was irregular hexagonal with rough surface. However, the particles appear to be merged with adjacent particles and this agglomerated structure may be due to the high surface charge of the particles and electrostatic attraction of ZnO‐NPs [18].

Fig. 5.

FESEM image of RP/ZnO‐NPs

3.5 Chemical reaction mechanism of RP/ZnO‐NPs

FTIR spectra were recorded in order to determine the interactions of RP water extract with zinc acetate dehydrate. Fig. 6 depicts the FTIR spectra of RP/ZnO‐NPs. The absorption peaks are in the range of 400–4000 cm⁻¹. The peaks at 615 and 681 cm⁻¹ indicate the presence of ZnO‐NPs [19]. However, strong band around 1028 and 1050 cm⁻¹ indicates the presence of C–O groups and 2932 cm⁻¹ band confirms the presence of CH groups. The peak in 3412 cm⁻¹ is assigned to the OH groups [20]. The absorption peaks at 1339, 1410 and 1572 cm⁻¹ are because of organic impurities, which is because of reaction intermediates [21].

Fig. 6.

FTIR result of RP/ZnO‐NPs

3.6 XRD results of RP/ZnO‐NPs

RP/ZnO‐NPs were subjected to XRD analysis in order to determine element compositions. Fig. 7 shows the results of XRD for RP/ZnO‐NPs. The XRD demonstrated characteristic ZnO diffraction maxima at 2Θ values of 31.8, 34.5, 36.2, 47.6, 56.6, 62.9, 66.4, 67.9, 69.1, 72.6 and 76.9 [22]. As can be seen in Fig. 7, the presence of oxygen and carbon on the elemental analysis was indicative of conjugated RP water extract with synthesised ZnO‐NPs [23].

Fig. 7.

XRD result of RP/ZnO‐NPs

3.7 Cytotoxic effects of RP/ZnO‐NPs

The cytotoxicity effect of RP/ZnO‐NP on breast carcinoma cells was examined by MTT assay. The results showed that RP/ZnO‐NP can reduce the proliferation of MDA‐MB‐231 cells. The calculated IC₅₀ for treated cells was 6 µg/ml in 48 h. In addition, it was shown that bio‐green synthesis ZnO‐NPs decreased cell viability in dose and time‐dependent manner. On the other hand, comparing the toxicities of NPs to cancer cells (Fig. 8) and normal cells (Fig. 9) 24 h after exposure revealed that the NP had a higher cytotoxic effect on cancer cells (6 µg/ml) compared with normal cells (above 50 µg/ml).

Fig. 8.

Percentage of viable MDA‐MB‐231 cells treated with RP/ZnO‐NP after 24, 48 and 72 h. Increasing concentrations of RP/ZnO‐NP lead to less per cent of the viable cell (***: P‐value<0.001). All in vitro experiments were performed in triplicate and expressed as the mean ± standard deviation

Fig. 9.

Percentage of viable human dermal fibroblast (HDF) cells treated with RP/ZnO‐NP after 24 h. (***: P‐value<0.001). All in vitro experiments were performed in triplicate and expressed as the mean ± standard deviation

3.8 Apoptosis induction assay results

Nuclear morphology changed in treated cells with RP/ZnO‐NP in AO/PI staining. AO/PI staining results showed that the treated cells with RP/ZnO‐NP displayed morphologic evidence of apoptosis, comparing with untreated groups. Morphological changes in treated cells were observed using AO/PI staining. The results of this survey exhibited that the RP/ZnO‐NP resulted in an increase in the percentage of apoptotic cells compared with the control group (Fig. 10).

Fig. 10.

Fluorescent images of MDA‐MB‐231 cells stained by AO/PI. Cells treated with concentrations of 6 and 12 µg/ml of RP/ZnO‐NP for 48 h compared with the control group

The apoptotic morphological alteration mentioned above was also established with a flow cytometric analysis. Charts show that the sub‐G1 population (apoptotic cells) increased from 2.8% at 0 μg/ml (control) to 47.2% at 6 μg/ml and 76.6% at 12 μg/ml concentrations, after treatment with RP/ZnO‐NP for 48 h and following that the G1 population (living cells) decreased and the other portions of non‐apoptotic cells did not show an important modification (Fig. 11).

Fig. 11.

Cell cycle analysis of MDA‐MB‐231 cells

(a) Control cells, (b) Treated with 3 μg/ml RP/ZnO‐NP for 48 h, (c) Treated with 6 μg/ml RP/ZnO‐NPs for 48 h, (d) Treated with 12 μg/ml RP/ZnO‐NPs for 48 h

3.9 Real‐time PCR

To evaluate changes in the CAT gene expression in treated cells compared with untreated cells, the gene expression rate was evaluated after 24, 48, 72 and 96 h exposure to concentrations of 3 and 6 µg/ml of RP/ZnO‐NP. For this purpose, the CAT gene expression was evaluated in treated cells with 3, 6 µg/ml of RP/ZnO‐NP s in 24, 48, 72 and 96 after treatment. Results indicated that expression of the CAT gene increases with increasing treatment time. In addition, the gene expression levels were different in various concentrations and increased by increasing concentration (Fig. 12).

Fig. 12.

Antioxidant capacity of RP/ZnO‐NPs by measuring the expression of the CAT gene in treated and untreated cells at 24, 48, 72 and 96 h after exposure. Data are expressed as the mean ± standard division

3.10 Antioxidant assay results

3.10.1 ABTS free radical scavenging capacity

To estimate the antioxidant capacity of RP/ZnO‐NPs, the scavenging capacity of ABTS was determined. As shown in Fig. 13, the RP/ZnO‐NPs are capable of inhibiting ABTS free radicals at IC₅₀ of 4 µg/ml. RP/ZnO‐NPs exhibited concentration‐dependent activity and the ABTS scavenging effect has been observed 77% at 25 µg/ml.

Fig. 13.

Radical inhibition activity of RP/ZnO‐NPs. Treated groups compared with BHA group. Data are expressed as the mean ± standard division

3.10.2 DPPH radical scavenging activity

The free radical scavenging capacity RP/ZnO‐NPs was also evaluated by DPPH scavenging activity. The RP/ZnO‐NPs showed a dose‐dependent activity and the DPPH scavenging effect was 59% at a concentration of 12.5 µg/ml (see Fig. 14).

Fig. 14.

Radical inhibition activity of RP/ZnO‐NPs. Treated groups compared with BHA group. Data are expressed as the mean ± standard division

4 Discussion

The present paper was designed in two sections: the first part was synthesis and characterisation of ZnO‐NPs via the bio‐green method in B. napus pollen water extract and the second part focuses on the evaluation of their anti‐cancer and antioxidant properties. Many works have already been taken to synthesise NPs from various plant species [24]. Researches show that synthesis of NPs using plant extract is an enzyme‐mediated process and the secondary metabolites exist in the plant extract such as phenolic compounds and also proteins are working as reducing agents and able to convert zinc ions to ZnO‐NPs [25]. In this paper, RP water extract was used for the synthesis of ZnO‐NPs. This method is novel, ecofriendly and cost‐effective compared with chemical methods and physical methods [26]. One of the characteristics of the formation of ZnO‐NPs is the change in the colour of dispersion and white sediment formation. The colour change of the solution containing the NPs may be due to excitation of free electrons in ZnO‐NPs synthesised by bioactive compounds present in plant extract. These compounds play an important role in stabilisation of ZnO‐NPs [25]. Formation of RP/ZnO‐NPs was observed in a mixture containing zinc acetate dihydrate solution. Other researchers also reported that this biosynthesis is depended to plant extract total mass [27]. UV–vis absorption curve of bio‐green synthesised ZnO‐NPs showed an absorbance peak near 300 nm, which indicated the formation of ZnO‐NPs (Fig. 1). This absorption is agreed with the absorbance peaks reported by Rensmo et al. [28] and Haase et al. [29] which synthesised ZnO‐NPs with the recorded value of 312 nm. The results of particle size and TEM micrograph showed that the synthesised NP has an average dimension of 26 nm, which confirms the presence of NPs in the composition consistent with similar reports for the production of ZnO‐NPs [30, 31]. FESEM images of ZnO nanostructure showed the irregular hexagonal NPs with a rough surface in agreement with ZnO nanostructure synthesised by Saravanakkumar et al. [32]. FTIR spectra of ZnO‐NPs prepared in RP water extract was carried out to detect the biomolecules that are responsible for capping and efficient stabilisation of the NPs. The absorption peaks at 615 and 681 cm⁻¹ related to the stretching vibrations of ZnO bonds [33, 34]. These peaks indicated the presence of ZnO‐NPs. The present symmetric stretching of C–O group confirmed with the presence of strong band around 1028 and 1050 cm⁻¹ that in agreement with the reported value (1015 cm⁻¹) by Mandak et al. [35]. The presence of a band at 2939 cm⁻¹ with confirming the presence of CH groups that are similar to the study done by Saravanakkumar et al. [32]. In the current paper, it is assumed that the hydrogen bond between the functional groups in the composition of phenyl acetic acid present in the RP water extract with the zinc acetate dihydrate [Zn(CH3COO)₂.2H₂O] reacted to produce NPs. It is suggested that initially Zn(OH)₂ produced in solution, which formed Zn² ⁺ and OH⁻ ions and after the nucleation of metal atoms, then small molecules of ZnO are formed [36]. The XRD results in the present paper, similar to another study, confirm the presence of NPs [32].

In the second part of the paper, the anti‐cancer and antioxidant activities of RP/ZnO‐NPs were investigated. The results showed that the synthesised NPs inhibited cancer cells more than normal cells (Figs. 8 and 9), which the results were similar with Namvar et al. [37] that reported inhibitory effects of ZnO‐NPs on CT‐26 mouse colon carcinoma and leukaemia. In the present paper, the AO/PI and flow cytometry results confirmed the induction of apoptosis in exposed cells with ZnO‐NPs. In the previous paper, the expression of genes associated with antioxidant activity such as the CAT gene has been investigated [38]. However, in the present paper, for the first time, changes in the expression of this gene have been investigated over a period of 96 h at specified time intervals. The results show that with increasing treatment time from 24 to 96 h, the expression of the CAT gene is significantly increased (Fig. 12). It should be noted that this is the first time that expression of the CAT gene as an antioxidant gene increases in concentration and time‐dependent manner in the treated cells. Considering the high surface area to volume ratio, it appears that these RP/ZnO‐NPs show a high tendency to interact with and reduce free radicals such as ABTS and DPPH. Another research also reported that in contrast with industrial ZnO‐NPs, bio‐green synthesised ZnO‐NPs have antioxidant properties [39], which also was shown in this paper.

5 Conclusion

Bio‐green synthesised ZnO‐NPs in B. napus pollen water extract showed anti‐cancer and antioxidant properties. Present results also support the advantages of using bio‐green method for the production of NPs having the potential of antioxidant and cytotoxic activities against cancer cells. In the future, by performing more thorough studies, these compounds can be used as antioxidant supplements as well as for the inhibition of cancer cells.