Single‐wall and multi‐wall carbon nanotubes promote rice root growth by eliciting the similar molecular pathways and epigenetic regulation

Abstract

Organisms are constantly exposed to environmental stimuli and have evolved mechanisms of protection and adaptation. Various effects of nanoparticles (NPs) on crops have been described and some results confirm that NPs could enhance plant growth at the physiological and genetic levels. This study comparatively analysed the effect of carbon nanotubes (CNTs) on rice growth. The results showed that single‐wall CNTs were located in the intercellular space while multi‐wall CNTs penetrated cell walls in roots. CNTs could promote rice root growth through the regulation of expression of the root growth related genes and elevated global histone acetylation in rice root meristem zones. These responses were returned to normal levels after CNTs were removed from medium. CNTs caused the similar histone acetylation and methylation statuses across the local promoter region of the Cullin‐RING ligases 1 (CRL1) gene and increased micrococcal nuclease accessibility of this region, which enhanced this gene expression. The authors results suggested that CNTs could cause plant responses at the cellular, genetic, and epigenetic levels and these responses were independent on interaction modes between root cells and CNTs.

1 Introduction

There exist complex interactions between nanoparticles (NPs) and biological organisms and NPs could be sensed by plants and affect their growth and development [1, 2]. The key factors including NP type [3], size [4], specific surface area [5], concentrations, and the plant species [6] influenced the interactions, which were regulated at multiple levels. Multi‐wall carbon nanotubes (MWCNTs) were toxic to the Arabidopsis T87 suspension cells, causing decrease in values of cell chlorophyll contents and superoxide dismutase activities [7]. Reactive oxygen species were increased and cell viability was decreased, accompanied with membrane rupture, cytoplasm leaking, and chromatin condensation when suspension rice cells were exposed to MWCNTs [8]. The internalisation of MWCNT could cause chromosomal aberrations, DNA fragmentation and apoptosis in allium root cells [9]. Single‐wall CNTs (SWCNTs) caused adverse cellular responses including cell aggregation, chromatin condensation along with a TdT‐mediated dUTP Nick‐End Labeling (TUNEL)‐positive reaction, plasma membrane deposition, and hydrogen peroxide accumulation [10].

Except for these negative physiological effects, some evidence suggests that the NPs could promote plant growth and development by regulation of gene expression. Khodakovskaya et al. [11] demonstrated that MWCNTs would stimulate germination rate by facilitating water uptake and increasing expression of the tobacco aquaporin (NTPIP1) gene and up‐regulate the expression of genes related to cell division (CycB) and cell wall extension (NtLRX1) to promote tomato cell growth. The expression of the genes encoding several types of water channel proteins was increased in soybean, corn, and barley seeds exposed to MWCNTs as compared with the control and seed germination was up‐regulated [12]. Ma's work on titanium dioxide (TiO₂) NP‐treated spinach found the promotion of rubisco carboxylation and the high rate of photosynthetic carbon reaction, which reflected the enhancement of rubisco activase mRNA expressions and activities of rubisco activase at the molecular level [13]. Moreover, TiO₂ NPs were proved to regulate the distribution of light energy from electron orbit (PS) I to PS II by increasing LHCII gene expression and LHCII contents, consequently accelerating the transformation from light energy to electronic energy, water photolysis, and oxygen evolution [14]. The gene coding the tomato water channel protein (LeAqp2) from tissues exposed to different concentrations of CNTs showed different transcriptional levels [15]. Arabidopsis roots treated with ZnO NPs, fullerene soot or TiO₂ NPs showed various regulation patterns of gene expression [16]. Our recent study showed that SWCNTs selectively influenced maize root tissue development by the regulation of the related gene expression and inhibition of acetylation of histone H3 at lysine 9 [17]. Epigenetic modification participated in gene expression and plant growth as post‐translational regulators when plants respond to environmental stresses [18]. Further study on NP‐induced epigenetic modification might provide a more comprehensive understanding of plant‐NPs interaction.

The aims of this paper were to compare the effect of SWCNTs and MWCNTs on the rice root growth and investigate the possible molecular mechanism. The result presented showed that both SWCNTs and MWCNTs promoted rice root growth and development, which was related to the similar regulation of the associated gene networks. CNTs were observed to cause global hyperacetylation of histone H3 in the nuclei from root meristem zone. After removing the CNTs, the epigenetic modification and interrelated gene expression returned to the similar level compared with the control. CNT exposure increased the CRL1 gene promoter chromatin accessibility to micrococcal nuclease (MNase) and gave rise to hyperacetylation and demethylation statuses across the CRL1 gene promoter region to up‐regulate the CRL1 gene transcription. Besides, SWCNT aggregates were detected in the interspace between the root cells and MWCNTs penetrated the cell walls. These findings further verified the link between the plant phenotypes and the associated genes affected by CNTs in direct contact with the plants and thus opened up possibility to identify the epigenetic mechanisms involved in the effect of NPs on plants.

2 Materials and methods

2.1 Nanotubes and characterisation

Commercially available SWCNTs (Outside Diameter (OD) 1–2 nm; length ≃ 30 µm; purity > 99.8%; ash < 1.5 wt%; specific surface area (SSA) > 380 m² /g; and electrical conductance (EC) > 102 S/cm) were purchased from Chengdu Organic Chemicals Co. Ltd., Chinese Academy of Sciences. MWCNTs (OD 20–40 nm; length ≃ 10–30 um; purity > 99.8%; ash < 8 wt%; SSA > 110 m² /g; and EC > 102 S/cm) were kindly provided by Institute of Nanoscience and Nanotechnology, Central China Normal University, Hubei Province, China.

2.2 Antibodies

The following histone modification antibodies were used for this paper. The anti‐H3K9ac antibody (catalog number 07–352), the anti‐H3K9me1 antibody (catalog number 07–450), the anti‐H3K9me2 antibody (catalog number 07–441), and the anti‐histone H3 antibody (catalog number 06–755) were purchased from Millipore (Billerica, MA, USA). The H4K5ac antibody (catalog number ab51997) was bought from Abcam (Cambridge, UK). The alkaline phosphatase (AP)‐conjugated goat anti‐rabbit immunoglobulin G (IgG) (catalog number A4187) was purchased from Sigma (St. Louis, MO, USA). The goat anti‐rabbit IgG (H + L) antibody‐fluorescein isothiocyanate (FITC) conjugate (catalog number: 12–507) was purchased from Millipore.

2.3 Plant materials

Rice seeds (Oryza sativa L. indica line 9311) were sterilised and grown in 1/2 Hoagland medium (0.75 mM magnesium sulphate, 0.5 mM monopotassium phosphate, 1.25 mM potassium nitrate, 1.5 mM calcium nitrate, 50 μM potassium chloride (KCl), 50 μM boric acid, 10 μM manganese sulphate, 2 μM zinc sulphate, 1.5 μM copper sulphate, 0.075 μM ammonium heptamolybdate, 10 μM ferric ethylenediaminetetraacetic acid (EDTA), 1% sucrose, and pH 6.0) containing 0.8% agarose with and without CNTs under continuous light for 7 d at 25°C and 70% relative humidity in a growth cabinet and then all seedlings (the control and pre‐treated seedlings) were transplanted to the normal liquid 1/2 Hoagland medium to keep culturing under the same condition. Each experimental group contained 90 seedlings and three independent experiments were performed. Only root examples were applied for these molecular and cytogenetic experiments.

2.4 Growth measurement

The lengths of the roots of each seedling were measured at different times. Rice seedlings were washed three times in double distilled water before the measurement. The images of the seedlings were captured with a Nikon D90 unilateral camera and imported to Image J (http://www.rsbweb.nih.gov/ij) for quantitative analysis of the root length. About 30 individual seedlings from the control and the treatment groups were measured for the length tests and three times repeated experiments were performed, respectively.

2.5 Western blotting assays

Western blot detection was executed as previously described [19]. The materials from rice roots were ground in liquid nitrogen, and then resuspended in the extraction buffer [100 mM Tris‐hydrochloride pH 7.4, 50 mM sodium chloride (NaCl), 5 mM EDTA, and 1 mM phenylmethylsulphonyl fluoride]. After centrifugation at 10,000g for 20 min at 4°C, ∼10 μg protein samples within 10 μl extracting solution buffer (50 mM Tris, pH 6.8, 100 mM DL‐Dithiothreitol (DTT), 10% glycerol, 2% sodium dodecyl sulphate, and 0.1% bromophenol blue) were loaded onto a 12% polyacrylamide gel and underwent the separation by electrophoresis. Moreover, then samples in the gel were transferred to a nitrocellulose membrane according to the manufacturer's instructions (Bio‐Rad, CA, USA). Primary antibodies (1:100 dilution) and the secondary antibody (the AP‐conjugated goat anti‐rabbit IgG, 1:1000 dilution) were used and chromogenic reaction was revealed after the treatment with a mixture of nitroblue tetrazolium and bromo‐chloro‐indolyl‐phosphate (NBT‐BCIP, Beyotime, China). Histone H3 was used as an equal loading control.

2.6 Immunostaining

Nuclei of root meristem regions from seedlings placed in Murashige and Skoog (MS) medium with and without CNTs for 3, 5, 7, and 14 d were fixed in 4% paraformaldehyde in 1 × Phosphate Buffered Saline (PBS) (135 mM NaCl, 4.7 mM KCl, 10 mM disodium phosphate (Na₂ HPO₄), 2 mM monosodium phosphate (NaH₂ PO₄), and pH 7.4) for 30 min at the room temperature. Immunostaining of nuclei on the slides was performed according to the method reported by Zhang et al. [20]. The primary antibody to H3K9ac and the secondary antibody (goat anti‐rabbit IgG (H + L) antibody‐FITC conjugate) were used in this paper. In control experiments, slides were incubated with the secondary antibody only. All slides were counterstained with DAPI (4’, 6‐diamidino‐2‐phenylindole, Sigma, USA, 0.2 µg/ml), mounted with Vectashield (Vector Laboratories, USA). Images captured with a Charge‐coupled Device (CCD) monochrome camera Sensys 1401E under an Olympus BX‐60 fluorescence microscope were pseudo‐coloured, deconvoluted and merged using the software MetaMorph^® 7.7.2 (Universal Imaging Corporation, USA). Microscope settings and camera detector exposure times were kept constant for each respective channel (exposure time: 300 ms for fluorescein or 30 ms for DAPI) but were optimised for individual experiments and more than 400 nuclei were analysed. Images were processed using Adobe Photoshop 9.0 software. For both control and treated cells, three independent immunostaining experiments were performed with each antibody. The mean grey values of the signal intensity were measured by Image J and MetaMorph.

2.7 Quantitative real‐time polymerase chain reaction

Total RNA was isolated from roots using the RNAprep pure Plant Kit (Qiagen, Germany). The purified RNA was reverse‐transcribed to cDNA by using RevertAid First Strand cDNA Synthesis Kit (Fermentas, Canada). Quantitative real‐time polymerase chain reaction (PCR) was carried out using Synergy Brands, Inc. (SYBR)^® Green real‐time PCR Master Mix (TOYOBO, Japan) in a StepOnePlus real‐time PCR system (Applied Biosystems, Carlsbad, USA) with the following cycling conditions: 94°C for 2 min, followed by 40 amplification cycles at 94°C for 5 s, 58°C for 15 s, and 72°C for 20 s. Fluorescence data were acquired at the 72°C step and during the melting‐curve programme. Preliminary experiments were run to ensure the amplification of a single PCR product for each gene. The rice Actin gene was used as a control. Quantitative PCR primers were designed to amplify 100–200 base pair or so fragments. The primers were shown in Table 1.

Table 1.

Primers used for quantitative real‐time PCR

Real Time (RT) PCR primer	Sequence, 5′–3′
Actin	TGTATGCCAGTGGTCGTACCA
	CCAGCAAGGTCGAGACGAA
CRL4	CTGTGGAGCTTGATGAATACAC
	CAAGCTTCTCAGGCAACAAATG
PIN1	CGAAGGACAGGGAGGACTACGTGG
	TGTTCGGGTTGCGGATGAG
ARF16	GCCTGTGGTTACCGAACTGA
	CTGAAGCTTCTCCTGCTCCC
CRL1	AGCAACGTGTCCAAGCTGCT
	GTCCTGGTGGTGTATCCCTT
WOX11	CCAGATGGGCGAGAGCTACT
	CGTTGCCATCGATCAATCAA

2.8 Chromatin immunoprecipitation (ChIP) assays

The ChIP assay was carried out with H3K9ac and H3K9me1 antibodies following the procedure described by Hu et al. [21]. During the ChIP assay, a negative control was performed using rabbit serum for mock immunoprecipitation. After ChIP, DNA was extracted with a standard procedure (phenol/chloroform/isoamyl alcohol) (25:24:1). Precipitated genomic DNA was subjected to real‐time PCR with primer sets A–E encompassing the promoter region. Quantitative real‐time PCR was performed according to the above‐mentioned procedure. The rice glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) gene was used as a control. The primers were listed in Table 2.

Table 2.

Primers used for quantitative CHART‐PCR and ChIP

ChIP and CHART‐PCR primer	Sequence, 5′–3′
GAPDH	GGGCTGCTAGCTTCAACATC
	TTGATTGCAGCCTTGATCTG
CRL1 set A	TCCCGTCATCTTGGCCG
	CTGCATCACCACCGCCT
CRL1 set B	TGAGGCGGTGGTGATGC
	ATAATGGAGCTGGTTGCCCA
CRL1 set C	GCTTGGCTGCTGTGAGACTA
	TCCATGGCCAGGTGATGTATG
CRL1 set D	AGGGACACAAGGAAAAGGGA
	TGCCTACAGCAGAGGAAAAA
CRL1 set E	AAGCATGGCTTTTGCCTTCC
	GGTAAGCATAGGGCAGGACC

2.9 Chromatin accessibility measured by chromatin accessibility by real‐time‐PCR

To analyse the chromatin conformational change, chromatin accessibility by real‐time PCR (CHART‐PCR) assay was carried out essentially according to the method described by Rao et al. [22]. Nuclei from the control and the CNT‐treated seedlings were prepared as described by Hu et al. [21]. Nuclei were then digested for 5 min at 37°C using 5 U MNase. Subsequently, DNA was prepared using a plant genomic DNA kit (Qiagen, Mannheim, Germany) and quantified using the Gene Quant calculator (Amersham Pharmacia Biotec, Piscataway, NJ, USA). About 100 ng of genomic DNA from the control or the CNT‐treated samples was used for SYBR Green real‐time PCR analysis with the same primer sets that were used for the ChIP assay. MNase accessibility was thought to be inversely proportional to the amount of amplified product.

2.10 Transmission electron microscopy

The root tissues of rice seedlings untreated and exposed to 20 mg/l CNTs for 7 d were fixed in a 4% paraformaldehyde and 2.5% glutaraldehyde mixture in 0.1 M potassium phosphate buffer (1.4 mM NaH₂ PO₄, 4.3 mM Na₂ HPO₄, pH 7.2) for 1 h at 25°C in the negative pressure environment and then at 4°C overnight. After rinsing with 0.1 M potassium phosphate buffer three times, the tissues were postfixed for 1 h in 1% osmium tetroxide. Moreover, then the tissues were dehydrated in an ascending ethanol series and embedded in Spurr's resin. The samples were cut to ultra‐thin sections with a diamond knife on an ultra‐microtome and mounted on copper grids. After stained with uranyl acetate and lead citrate, these ultra‐thin sections were observed in a HITACHI H‐8100 transmission electron microscope (TEM) at an accelerating voltage of 150 kV.

3 Results

3.1 Rice root growth and development

More and more studies about the effects of NPs on crops confirmed that NPs could enhance germination and seedling growth [23]. In this paper, we investigated the effect of different concentrations of SWCNTs and MWCNTs on rice seedling growth. The results showed that CNTs promoted the rice seedling growth. The root system showed the similar status after recovery (Fig. 1 a). As demonstrated in Fig. 1 b, the primary root (PR) length was enhanced by five‐fold after CNTs were added to the medium for 1 d. About 5 mg/l CNTs increased the PR length by 17–29%, while 20 mg/l CNTs increased by about 45–70% after 3 and 7 d of exposure. The crown root (CR) length of the seedlings grown on media with different concentrations of CNTs all increased approximately by twice after 3 d of exposure and increased by 40–125% after treatment for 7 d compared with seedlings grown in control media (Fig. 1 c). The lateral root (LR) length increased by 80% after exposure of SWCNTs for 7 d and by 700% after treatment with MWCNTs for 7 d (Fig. 1 d). Thus, the addition of CNTs to the medium resulted in an increase in root growth of rice seedlings. Moreover, there were no significant differences between different groups after recovery for 2 weeks (Figs. 1 b –d).

Fig. 1.

CNTs promoted rice seedling growth during germination. Results are shown as average ± the standard error (SE) of measurements of three independent experiments. *Denotes significant differences (p < 0.05) from the exposed seedlings using the Student t‐test

a Phenotype of rice seedlings

b Mean PR length

c Mean CR length

d Mean LR length of rice seedlings untreated and treated with CNTs for 1, 3 and 7 d and removed from CNTs for 14 d. Note: significant difference is found in PR length for 1, 3 and 7 d between the control and CNT treatment, in CR length for 3 and 7 d between the control and CNT treatment and in LR length for 3 and 7 d between the control and CNT treatment

3.2 Transcriptional levels of genes related with rice root development

Gene regulatory network controls root initiation and development [24]. Our previous study showed that SWCNTs caused the changes in expression of the root development related genes, and consequently affected relative root growth and development in maize [17]. On the basis of observations in Fig. 1, we supposed that CNTs would change the expression of the related genes. To test this hypothesis, the mRNA levels of genes which are essential for rice root development such as CRL4 and CRL1 were determined by real‐time quantitative PCR analysis. The transcript levels of CRL4 were increased after the addition of SWCNTs to the medium for 3 or 7 d (Fig. 2 a). MWCNTs significantly elevated the CRL4 expression, which was increased by over 50‐fold after treatment with 5 mg/l MWCNT for 7 d and by over 100‐fold after 20 mg/l MWCNT exposure for 7 d (Fig. 2 b). Seedlings recovered from MWCNT and SWCNT exposure for 3 d, respectively, showed a reduction of 20 and 60% in CRL4 transcriptional levels when compared with the control seedlings and then the level got as similar as that of the control seedlings following the 7 d of recovery (Fig. S1a). Significant up‐regulation of CRL1 was detected in roots exposed to CNTs for 7 d (Figs. 2 c and d). CRL1 transcription was reduced within the first 3 d after transferred to medium without CNTs, and then the CRL1 transcript level of pre‐CNT‐treated seedlings turned to as similar as that of the control seedlings after 7 d of recovery (Fig. S1b). Additionally, it was found that the auxin efflux carrier protein PINFORMED 1 (PIN1), auxin response factor 16 (ARF16) and WHUCHEL‐related homeobox gene (WOX11) transcript of seedlings was up‐regulated by CNT exposure (Figs. S2 and S3). Our findings have highlighted that the transcription of the rice root regulator can be significantly changed by CNTs, which is essential for the enhancement of rice root growth and such multifaceted effects would be vanished after removal of CNTs.

Fig. 2.

Quantitative real‐time PCR analysis of the transcript of the rice CRL4 and CRL1 genes in untreated seedlings, CNT‐exposed seedlings and restored pre‐CNT‐treated seedlings at different time points

a Transcription of CRL4 in SWCNT‐treated seedlings

b Transcription of CRL4 in MWCNT‐treated seedlings

c Transcription of CRL1 in SWCNT‐treated seedlings

d Transcription of CRL1 in MWCNT‐treated seedlings. The y ‐axis indicates relative expression values and the x ‐axis indicates days after treatment. Expression values were normalised to those of the actin gene. Each experiment was repeated three times and the average value is shown with the SE

3.3 Up‐regulation of acetylation levels in the rice root meristem zone

Global acetylation and deacetylation are involved in plant responses to environmental stress [25, 26]. To further comprehend the effect of CNTs on rice root elongation, histone modification changes of rice seedlings exposed to SWCNTs and MWCNTs were tested. Protein blot detection indicated that the global chromatin H3K9ac level from the SWCNT‐exposed seedlings was slightly increased, whereas the H4K5ac level did not change and the H3K9me2 level showed a reduction (Fig. 3 a). The H3K9ac and H4K5ac levels of the rice seedlings grown in medium supplemented with MWCNTs were slightly raised after 4 or 6 d and H3K9me2 level was down‐regulated a little (Fig. 3 c). These subtle changes of H3K9ac and H4K5ac levels disappeared after removal of CNTs from the medium (Figs. 3 b and d). Region‐specific epigenetic modification was detected in barley roots [27]. Thus, chromatin immunostaining in situ of nuclei from root meristem zone was analysed. The results showed that the H3K9ac level increased gradually during germination and CNTs hastened the process (Fig. 4). The CNT‐exposed seedlings showed brighter immunosignals compared with the control and similar intensity was detected after the removal of CNTs (Fig. 4 a). Quantification of the signal intensity by measuring mean grey values showed that histone H3K9 acetylation was increased by 23–68% in SWCNTs‐treated seedlings and 17–59% in MWCNTs‐treated seedlings (Fig. 4 b). The chromatin was reverted to the normal acetylation state after 7 d of recovery (Fig. 4 b).

Fig. 3.

Analysis of acetylation and methylation levels by Western blot. Protein samples were extracted from

a SWCNT‐treated seedlings

b Seedlings recovered from pre‐SWCNT treatment

c MWCNT treated seedlings

d Seedlings recovered from pre‐MWCNT treatment. Each experiment was repeated three times

Fig. 4.

Analysis of H3K9ac levels by immunostaining

a Immunosignals of nuclei from the control and treated seedlings

b Mean grey values of the immunostaining signals for histone acetylation. DAPI was used as a counterstain. Bar = 5 µm. More than 400 nuclei were analysed and the average value is shown with the SE

3.4 Chromatin modification in the CRL1 gene promoter region

Chromatin decondensation of some gene loci occurred on induction of transcription [28]. Decondensed chromatin regions are more accessible to MNase cleavage and fewer PCR products would be generated using CHART‐PCR analysis [29]. The CRL1 gene promoter contains auxin responsive elements. Hyperacetylation and demethylation on lysine 9 in histone H3 in CNTs‐treated plants occurred in the CRL1 gene promoter region compared with untreated seedlings at 7 d (Figs. 5 a and b). As expected, the region adjacent to the ARF16 binding site (set B) appeared a much higher acetylation level after CNT treatment (Fig. 5 a), while monomethylation of all promoter region was down‐regulated (Fig. 5 b). As shown in Figs. 6 a –c, all measured regions were relatively accessible to MNase in seedlings treated with CNTs for 7 d compared with the control seedlings. Acetylation and demethylation on Lys 9 in the H3 tail were associated with transcriptional activity in eukaryotic cells [30]. It could be concluded from these results that CNTs induced chromatin modification change of CRL1 gene promoter regions, which brought about up‐regulation of CRL1 gene expression.

Fig. 5.

CNTs induced changes of chromatin modification at the promoter region of the CRL1 gene. ChIP analysis showed comparison of

a H3K9ac

b H3K9me1 levels in the CRL1 gene promoter region

c Schematic representation of the CRL1 gene from −1252 to +9. The y ‐axis indicates the amount of PCR products and the x ‐axis indicates the different DNA regions. The data shown are the mean and SE of triplicate PCR from three independent experiments

Fig. 6.

Analysis of MNase accessibility by CHART‐PCR. CHART‐PCR was performed on nuclei that were extracted from

a 7 day Old seedlings untreated and treated

b SWCNTs

c MWCNTs

y ‐Axis indicates the amount of PCR products and the x ‐axis indicates the different DNA regions. The data shown are the mean and SE of triplicate PCR resulting from three independent experiments

3.5 TEM analysis

TEM ultra‐microcut observation can help understanding of how CNTs enter cells and where they migrate and locate [8]. Black particles were absent in sections from the control sample (Figs. 7 a and b). However, black bundles or aggregates were observed in intercellular spaces in the ultra‐thin section from the rice seedling treated with SWCNTs (Fig. 7 c), while MWCNTs were detected to penetrate rice cell walls (Fig. 7 d).

Fig. 7.

TEM image of untreated rice seedlings and CNT‐exposed seedlings for 7 d

a, c and d Image showing rice root tissues from the control, SWCNT‐ and MWCNT‐treated rice seedlings

b Image showing a high magnification of rice root tissues in control group. Note: SWCNT bundles or aggregates (white arrows point to) were observed in intercellular spaces. MWCNTs (black arrows point to) were observed to penetrate through two cells. Bar in a, c and d = 2000 nm; b = 700 nm. Each experiment was repeated three times

4 Discussion

4.1 Different CNTs display diversified interactions with rice cells but both promote rice root growth

The effects of NPs on plants are very complicated and are related to many factors such as types, nanotube sheets, plant species, and plant tissues. The positive and negative effects of the engineered nanomaterials on organisms have been reported. Our results added new evidence for the positive effects of CNTs on plant growth. SWCNTs enhanced root elongation in onion, cucumber, and corn [3, 17]. Germination rate and shoot weight of rice were increased after exposed to SWCNTs [31]. Activation of growth was observed in MWCNT‐exposed plants including wheat, barley, corn [32] etc. MWCNTs and activated carbon (AC) both stimulated cell growth during tobacco cell culture [11]. Many toxic metabolites can be absorbed by AC that have very fine network of pores with a large inner surface area, so cell growth and development would be improved [33]. CNTs were sensed by cells in a manner similar to an environmental stress [11]. Black aggregates composed of SWCNTs were detected in intercellular spaces of the rice root, in agreement with our previous study on maize [17]. It has been also reported that SWCNTs enter cells by endocytosis [34]. MWCNTs were found to penetrate rice cell walls, supporting the observation that MWCNTs were absorbed by the tobacco cells [11] and could penetrate the wheat root cells [32]. Actually some chemicals such as phenanthrene were taken up into the cellular cytoplasm though the channel made by MWCNTs [35]. Though distinct CNTs displayed different interactions with plant cells, the similar positive effect on plant growth was observed.

The observation that there were no significant differences between different groups after recovery for 2 weeks and various responses at genetic levels were returned to normal levels after CNTs were removed from medium suggested that sustaining contact was necessary for CNTs enhanced rice root growth. It was difficult to detect CNTs in the root samples after 7 d of recovery because the root cells were geometrically increased due to proliferating to dilute CNTs in the tissues when the seedlings were incubated in the medium without CNTs. As a result, the effect of CNTs was decreased. Another possibility is that these CNTs loose ‘activity’ after a long term of recovery. The further field experiment will help understand the effect of CNTs in a longer incubation time on rice growth.

4.2 SWCNTs and MWCNTs cause a similar signalling network that regulates rice root development

The root system architecture is highly influenced by environmental cues [36]. Plants respond to environmental stress by changing their morphology or growth rate through induction or repression of expression of the related genes [37]. A direct correlation between root development change and the expression of related genes in response to SWCNTs was reported [17]. The up‐regulation of rice root growth rate was controlled by the complex gene regulatory networks that could be stimulated by CNTs. It has been experimentally proved that WOX11 gene expression is important for maintaining proper rates of cell division in meristems and WOX11 mutant has a reduced development of the PR [38, 39]. The up‐regulation of expression of the WOX11 gene is correlated with the observed enhanced growth of the PR exposed to CNTs compared with the control seedlings. The CRL4 and CRL1 genes play a key role during rice CR and LR development [40, 41]. During rice root growth and development, the expression of CRL4 regulates the traffic of PIN1 that in turn modulates polar auxin transport. Auxin promotes the expression of the ARF16 gene that up‐regulates the CRL1 gene expression [42]. The CRL1 mutant is devoid of CRs and carries fewer LRs [41]. Moreover, WOX11 gene is expressed in the early CR primordia and is involved in CR development [43]. The over‐expression of these genes has contributed to the observed enhancement in rice root growth by CNTs, and the expression levels of CRL4 and CRL1 genes in seedlings after recovery turned to the similar level as that of the control seedlings. This observation revealed a direct and strong correlation between the changes of the root phenotype and the regulation of related gene expression in response to CNTs.

4.3 Chromatin regulation is involved in CNT‐induced gene expression during root growth

Gene expression driven by developmental and stress cues often depends on nucleosome histone post‐translational modifications [18]. Developmental and environmental signals can induce chromatin modification changes in the genome [44]. Hu et al. [21, 45] found significantly decreased levels of acetylated histones of the genome in cold‐treated plants. Total acetylation and deacetylation are thought to allow for rapidly restoring acetylation levels after the removal of stresses [25, 26] and may function to control basal transcription [25]. Global H3K9ac levels were slightly increased in the root meristem region after CNT treatment and were recovered after the removal of CNTs from the medium, which is agreement with this proposal [25]. It has been reported that histone H3K9 acetylation and decondensation of chromatin in the promoter of a gene are thought to be associated with its transcription, whereas H3K9me would always be related to the transcriptional repression [46]. Expression of the Vp1 gene is related to selective histone acetylation in the promoter region during maize seed germination [20] and cold induced an increase in acetylation of the ICE1 binding region leading to expression of cold‐related genes [21]. CNT treatment resulted in histone hyperacetylation and hypomethylation of the CRL1 promoter region, accompanied by an increase in accessibility of chromatin to MNase. The data presented here suggested that chromatin modification‐associated gene expression led to CNT‐enhanced rice seedling growth and development.

Changes of overall acetylation level and chromatin modification in particular gene loci sometimes showed inconsistent trends. For example, selective accumulation of acetylated histone H3 associated with the promoter region was detected, while global histone acetylation of the genome was down‐regulated with abscisic acid (ABA) treatment during maize seed germination [20]. Moreover, histone hyperacetylation occurred in the ICE1 binding region after cold treatment of maize though overall acetylated levels decreased [21, 45]. In this paper, the global chromatin H3K9ac level from the CNTs‐exposed seedlings was slightly increased. However, histone hyperacetylation occurred in the CRL1 promoter region. In addition, our results showed that MWCNTs induced higher H3K9ac levels at the CRL1 gene promoter region than SWCNTs, whereas SWCNTs led to a more decreasing amplitude in the H3K9me level than MWCNTs at the same region. How these are accomplished is unknown. It is likely that the different localisation of CNTs in the rice roots is involved in these processes. The molecular mechanism underlying the effect of CNTs on chromatin modification remains to be explored.