Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
List of primers.
| Gene Name | Forward Primer | Reverse Primer |
|---|---|---|
| B2M | GAGTATGCCTGCCGTGTGAA | GCTTACATGTCTCGATCCCACT |
| Piezo1 | GeneCopoeia All-in-OneTM qPCR primer for human PIEZO1 | N/A |
| Piezo2 | GeneCopoeia All-in-OneTM qPCR primer for human PIEZO2 | N/A |
| FilaminA | Filamin A (FLNA) human qPCR primer pair (NM_001456) | N/A |
| FilaminB | Filamin B (FLNB) human qPCR primer pair (NM_001457) | N/A |
