REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Anti-human IgG-AF488	Jackson ImmunoResearch	109-545-003; RRID: AB_2337831
mAbs 1-36, 40-135	This paper.	N/A
CR3022	ter Meulen et al., 2006	PDB : 6W41
Anti-mouse IgG1-PE [RMG1-1]	BioLegend	406608; RRID:AB_10551618
Anti-mouse IgG1-APC [RMG1-1]	BioLegend	406610; RRID:AB_10696420
Anti-human CD69 (mouse-IgG1) [FN50]	BioLegend	310902; RRID:AB_314837
Bacterial and virus strains
Pseudotyped SARS-CoV-2	Hanke et al., 2020	N/A
Biological samples
PBMCs and Serum	Patient specific. Part of SERO-BL-COVID19 biobank.	N/A
Chemicals, peptides, and recombinant proteins
Strep-Tactin-APC	Iba-lifesciences	6-5010-001
Strep-Tactin-HRP	Iba-lifesciences	2-1502-001
Human ACE2 (His tagged)	SinoBiological	10108-H08H
SARS-CoV-2 S1 (Avi-tag, biotinylated)	AcroBiosystems	S1N-C82E8
SARS-CoV-2 S1-mFc	SinoBiological	40591-V05H1
SARS-CoV-2 S2-mFc	SinoBiological	40590-V05B
SARS-CoV-2 S (Ectodomain)	SinoBiological	40589-V08B1
SARS-CoV-2 RBD-mFc	SinoBiological	40592-V05H
SARS-CoV-2 Nucleocapsid	SinoBiological	40588-V08B
SARS-CoV-2 RBD (Alpha) biotinylated (N501Y)	AcroBiosystems	SPD-C82E6
SARS-CoV-2 RBD (Beta) biotinylated (K417N, E484K, N501Y)	AcroBiosystems	SPD-C82E5
SARS-CoV-2 RBD (Gamma) biotinylated (K417T, E484K, N501Y)	AcroBiosystems	SPD-C82E7
SARS-CoV-2 RBD (Delta) biotinylated (L452R, T478K)	AcroBiosystems	SPD-C82ED
SARS-CoV-2 RBD (Delta+) biotinylated (K417N, L452R, T478K)	AcroBiosystems	SPD-C82EG
SARS-CoV-2 RBD (Epsilon) biotinylated (L452R)	AcroBiosystems	SPD-C82E3
SARS-CoV-2 RBD (Kappa) biotinylated (L452R, E484Q)	AcroBiosystems	SPD-C82EC
SARS-CoV-1 S1	SinoBiological	40150-V08B1
MERS-CoV Spike	SinoBiological	40069-V08B
HCoV-229E Spike	SinoBiological	40605-V08B
HCoV-OC43 Spike	SinoBiological	40607-V08B
HCoV-NL63 Spike	SinoBiological	40604-V08B
HCoV-HKU1	SinoBiological	40606-V08B
DMEM GlutaMax	Gibco	61965-026
RPMI 1640	Gibco	A10491-01
Ultra-low IgG Fetal bovine serum	Gibco	16250-078
HEPES 1M	Gibco	15630-080
Penicillin/Streptamycin	Gibco	15140-122
2-beta-mercaptoethanol	Gibco	31350-010
Critical commercial assays
Strep-Tactin® Buffer W	Iba-lifesciences	2-1003-100
Strep-Tactin® Buffer E (desthiobiotin)	Iba-lifesciences	2-1000-025
Strep-Tactin® Buffer R (HABA)	Iba-lifesciences	2-1002-100
Strep-Tactin® Sepharose	Iba-lifesciences	2-1201-002
Protein G Agarose	Pierce	20399
Protein G Elution Buffer	Pierce	21004
SF Nucleofector® Kit S	Lonza	V4XC-2032
SF Nucleofector® Kit L	Lonza	V4XC-2024
Octet Streptavidin Biosensors	ForteBio	18-5019
10X Kinetics Buffer	ForteBio	18-1105
Chromium Single Cell 5’ Library & Gel Bead Kit	10x Genomics	PN-1000006
Chromium Single Cell 5’ Library Construction Kit	10x Genomics	PN-1000020
Chromium Single Cell V(D)J Enrichment Kit, Human B cell	10x Genomics	PN-1000016
Chromium Single Cell A Chip Kit	10x Genomics	PN-1000009
Chromium i7 Multiplex Kit	10x Genomics	PN-120262
EasySep Human CD138 Pos Selection Kit II	STEMCELL	17877
Illumina MiSeq v3 kit (600 cycle)	Illumina	MS-102-3003
Deposited data
Fully annotated extracted antibody sequences and single cell results	This paper, Mendeley data	Table S1. CellRanger metrics—resulting sequencing reads and cell numbers determined from CellRanger version 3.1.1.0, for all patient samples, related to STAR, Table S4. Sequence similar hits in databases, https://dx.doi.org/10.17632/rvd7999gk4.1
Patient VDJ data, raw FASTQ	Patients from SERO-BL-COVID19 study. This paper.	http://www.ncbi.nlm.nih.gov/bioproject/782883
Enriched hybridoma NGS, raw FASTQ	This paper.	http://www.ncbi.nlm.nih.gov/bioproject/782992
Experimental models: Cell lines
HEK293T-ACE2	Hanke et al., 2020	N/A
mRuby+ Cas9+ PnP Hybridoma	Pogson et al., 2016	N/A
nPnP Hybridoma	This paper.	N/A
Expi293F	ThermoFisher	Cat#A14635
Oligonucleotides
crRNA-3, ATATGACTCCTTCGACTCGA	This paper. IDT	N/A
Recombinant DNA
Patient-derived mAb HDR constructs	This paper	N/A
pTWIST transient expression constructs	This paper. TWIST bioscience	N/A
Software and algorithms
FlowJo X	FlowJo, LLC	https://www.flowjo.com/solutions/flowjo
GraphPad Prism 9.2.0	GraphPad	https://www.graphpad.com/
Original code	This paper	https://github.com/LSSI-ETH/Ehling_Covid_2021, zenodo: https://dx.doi.org/10.5281/zenodo.5781348
R 4.0.1 (+ ggplot2, ComplexHeatmap, RColorBrewer, stringdist, igraph packages)	R Core Team, Gu et al., 2016, Neuwirth, 2014, van der Loo, 2014, Csardi and Nepusz, 2006)	N/A
CellRanger v3.1.1.0	10x Genomics	https://github.com/10XGenomics/cellranger
Immcantation v3.0.0 (pRESTO/IgBlast)	Vander Heiden et al., 2014	https://hub.docker.com/r/kleinstein/immcantation
MiXCR	Bolotin et al., 2015	https://mixcr.readthedocs.io/en/master/assemble.html