Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
| Primer name | Tm | Sequence (5′–3′) | Expected amplicon length (bp) |
|---|---|---|---|
| tufGF4_MD (Forward) | 58.5 °C | GGTGCAGCYCAAATGGATGG | 800 |
| tufAR_MD (Reverse) | 63.3 °C | CCTTCACGAATTGCAAAACGC |
Notes.
