Figure 2.
Design of guide RNA and identification primer. (A) Guide #5 TGATGCAATGGTCAGAGATGTGG; (B) the sequencing result of the activity verification; (C) the optimized amino acid sequence alignment (the lowercase font is the optimized base).
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.