Multiomic analysis identifies CPT1A as a potential therapeutic target in platinum-refractory, high-grade serous ovarian cancer

. 2021 Dec 21;2(12):100471. doi: 10.1016/j.xcrm.2021.100471

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies

P-Tyr-1000 rabbit antibody	Cell Signaling Technology	Cat#8954S; RRID:AB_2687925
diGly	Cell Signaling Technology	Cat#5562
acetyl-lysine motif	Cell Signaling Technology	Cat#13416
anti-rabbit IgG HRP-linked secondary antibody	Cell Signaling Technology	Cat#7074; RRID: AB_2099233
recombinant anti-CPT1A antibody	Abcam	Cat#ab220789; RRID: AB_2847832
recombinant anti-CPT1B antibody	Abcam	Cat#ab134135; RRID: AB_2847833
recombinant anti-CPT2 antibody	Abcam	Cat#ab181114; RRID: AB_2687503
CPT1C-specific antibody	Proteintech	Cat#12969-1-AP; RRID: AB_2084844
GAPDH antibody	Cell Signaling Technology	Cat#5174; RRID: AB_10622025
phospho-Histone H2A.X (Ser139) antibody	Cell Signaling Technology	Cat#9718; RRID: AB_2118009
Caspase-3 antibody	Cell Signaling Technology	Cat#9662; RRID: AB_331439
a-Actinin (D6F6) XP antibody	Cell Signaling Technology	Cat#6487; RRID: AB_11179206
NRF2 antibody	Proteintech	Cat#16396-1-AP; RRID: AB_2782956
histone H3 antibody	Proteintech	Cat#17168-1-AP; RRID :AB_2716755

Biological samples

Patient-derived xenografts, platinum sensitive	Mayo Clinic, Rochester, MN	PH013, PH063, PH077, PH088, PH242, PH249, PH299, PH361, PH423, PH454
Patient-derived xenografts, platinum refractory	Mayo Clinic, Rochester, MN	PH026, PH048, PH271, PH341, PH550, PH081, PH232, PH586, PH626, PH763

Chemicals, peptides, and recombinant proteins

Carboplatin	APP Pharmaceuticals, Selleckchem	Cat#S1215
Urea	Sigma-Aldrich	Cat#U0631
Trizma base (Tris)	Sigma-Aldrich	Cat#T2694
iodoacetamide (IAM)	Sigma-Aldrich	Cat#A3221
EDTA	Sigma-Aldrich	#E7889
EGTA	Sigma-Aldrich	#E0396
Phosphatase Inhibitor Cocktail 2	Sigma-Aldrich	#P5726
Phosphatase Inhibitor Cocktail 3	Sigma-Aldrich	#P0044
Protease Inhibitor Cocktail	Sigma-Aldrich	#P8340
phosphate buffered saline	Thermo Fisher Scientific	#BP-399-20
tris(2-carboxyethyl)phosphine	Thermo Fisher Scientific	Cat#77720
DTT	Sigma-Aldrich	Cat#11583786001
EPPS	Sigma-Aldrich	Cat#E9502
Lys-C	Wako	Cat#12505061
trypsin	Promega	Cat#V5111
TMT reagents	Thermo Fisher Scientific	Cat#90406
100 mg Sep-Pak solid-phase extraction column	Waters	Cat#WAT023590
protein A-agarose beads	Sigma-Aldrich	Cat#11134515001
Fe-NTA phosphopeptide enrichment kit	Thermo Fisher Scientific	Cat# A32992
Protein A resin	Thermo Fisher Scientific	Cat#53142
StageTip	Thermo Fisher Scientific	Cat#SP301
Acetonitrile	Sigma-Aldrich	Cat#A955
water	Sigma-Aldrich	Cat#W6
ammonium bicarbonate	Sigma-Aldrich	CatA6141
mirin	Selleckchem	Cat#S8096
etomoxir	Sigma-Aldrich	Cat#E1905
perhexiline	Sigma-Aldrich	Cat#SML0120
N-Acetyl-L-cysteine	Sigma-Aldrich	Cat#1009005
Carboplatin, clinical grade	Mayo Clinic Pharmacy	N/A
Etomoxir, clinical grade	Target Molecule Corporation	Targetmol T4535
Perhexiline, clinical grade, obtained as Pexsig (perhexiline maleate tablet, 100mg)	Aspen Pharma Pty Ltd	N/A

Critical commercial assays

AllPrep DNA/RNA FFPE kit	QIAGEN	Cat#80234
QIAmp DNA FFPE Tissue kit	QIAGEN	Cat#56404
miRNeasy FFPE kit	QIAGEN	Cat#217504
Illumina TruSeq stranded Total RNA sample preparation kit	Ilumina	Cat#20020597
Kapa DNA Hyper prep reagents	Roche Diagnostics Corporation	Cat#KK8504
Micro BCA assay	ThermoFisher Scientific	Cat#23235
crystal violet assay kit	Abcam	Cat#ab232855
Cellular Reactive Oxygen Species Detection Assay Kit	Abcam	Cat#ab186027
Synthego’s Gene Knockout Kit V2	Synthego	N/A
FITC Annexin V Apoptosis Detection Kit I	BD PharMingen	N/A

Deposited data

Cell line and PDX proteomics datasets (Global, phospho, acetyl, ubiquitin, pTyr-enriched proteomics)	This paper	PRIDE: PXD020764
RNA sequencing data	This paper	GEO: GSE163152
Genome sequencing data	This paper	SRA: PRJNA684350
TCGA CPTAC Ovarian cancer data	Zhang et al.⁹⁰	https://proteomics.cancer.gov/data-portal
PTMsigDB v1.9	Krug et al.¹⁶²	https://github.com/broadinstitute/ssGSEA2.0
PhosphoSitePlus	Hornbeck et al.¹⁶³	https://www.phosphosite.org
HPRD v9.0	Keshava Prasad et al.¹⁶⁴	http://hprd.org
MSigDB Canonical Gene Sets (C2 CP)	Liberzon et al.¹⁶⁵	https://www.gsea-msigdb.org/gsea/msigdb/index.jsp
CORUM	Giurgiu et al.⁷²	https://mips.helmholtz-muenchen.de/corum

Experimental models: cell lines

Human: PEO1	Toshiyasu Taniguchi, Sigma-Aldrich	RRID: CVCL_2686
Human: PEO4	Toshiyasu Taniguchi, Sigma-Aldrich	RRID: CVCL_2690
Human: PEA1	Sigma-Aldrich	RRID: CVCL_2682
Human: PEA2	Sigma-Aldrich	RRID: CVCL_2683
Human: PEO14	Sigma-Aldrich	RRID: CVCL_2687
Human: PEO23	Sigma-Aldrich	RRID: CVCL_2689
Human: FT-4 non-tumorigenic fallopian tube cell line (SV40 immortalized)	Drs. Anna Lokshin and Katherine Aird	N/A
HEK293T	Sigma-Aldrich	RRID: CVCL_0063

Experimental models: organisms/strains

female SCID beige mice (C.B.-17/IcrHsd- Prkdcscid Lystbg)	ENVIGO	N/A

Oligonucleotides

BRCA2 primer: 5′-CTATTGAG ACTGTGGTGCCACCTAAG	Thermo Fisher Scientific/Invitrogen	Custom oligos
BRCA2 primer: 5′-GCAGGGT GAAGAGCTAGTCACAAGTT	Thermo Fisher Scientific/Invitrogen	Custom oligos
CPT1A guide #1: U∗C∗U∗GAUGAACUUCU UUUUCC + synthego modified EZ scaffold	Synthego	N/A
CPT1A guide #2: G∗A∗G∗CUUCAUGGCU CAGCCGC + synthego modified EZ scaffold	Synthego	N/A
CPT1A guide #3: G∗G∗C∗AGAAG CUCACCAAGCUG + synthego modified EZ scaffold	Synthego	N/A
CPT1A PCR forward primer: 5′-CCT GATGATCATCTTGGGGCTC	Thermo Fisher Scientific/Invitrogen	Custom oligos
CPT1A PCR reverse primer: 5′-CCT CCTATTAAGTAGGTCGCTGGC	Thermo Fisher Scientific/Invitrogen	Custom oligos
CPT1A sequencing primer: 5′-TCT TTGTAGCGGTGGACAGGC	Thermo Fisher Scientific/Invitrogen	Custom oligos

Recombinant DNA

CPT1A WT	Taro Hitosugi	Kurmi et al.¹⁰⁶
CPT1A G710E	Taro Hitosugi	Kurmi et al.¹⁰⁶
pLHCX vector	Taro Hitosugi	Kurmi et al.¹⁰⁶
EcoPac	Taro Hitosugi	Kurmi et al.¹⁰⁶
pAmphopac	Taro Hitosugi	Kurmi et al.¹⁰⁶
pVSVG	Taro Hitosugi	Kurmi et al.¹⁰⁶

Software and algorithms

ComBat	Johnson et al.¹⁶⁶	https://www.bioconductor.org/packages/release/bioc/html/sva.html
sumer	Savage et al.¹⁶⁷	https://github.com/bzhanglab/sumer
GSVA	Barbie et al.⁵⁴	https://bioconductor.org/packages/release/bioc/html/GSVA.html
PTM-SEA	Krug et al.¹⁶²	https://github.com/broadinstitute/ssGSEA2.0
WebGestalt	Liao et al.¹⁶⁸	http://webgestalt.org
ImageJ	Schneider et al.¹⁶⁹	https://imagej.nih.gov/ij/
Summit	Beckman Coulter	N/A
ComplexHeatmap	Gu et al.¹⁷⁰	https://www.bioconductor.org/packages/release/bioc/html/ComplexHeatmap.html
R	The R Foundation	https://www.r-project.org
SAS	SAS Institute Inc.	https://www.sas.com/en_us/home.geo.html
Sequest-based software pipeline	Huttlin et al.¹⁷¹	https://gygi.hms.harvard.edu/software.html
Ascore	Rose et al.¹⁷² and Erickson et al.¹⁷³	https://gygi.hms.harvard.edu/software.html
BIC-seq	Xi et al.¹⁷⁴	https://github.com/ding-lab/BICSEQ2
GISTIC	Mermel et al.¹⁷⁵	https://github.com/broadinstitute/gistic2
wilcox.test	Bauer¹⁷⁶	Base R-package: stats
nlme	Laird and Ware¹⁷⁷	https://cran.r-project.org/web/packages/nlme/index.html

Other

Web portal for data visualization	This paper	https://sites.google.com/view/ptrc-cell-line