Abstract
Background:
One of the causes of male infertility is Genital tract infections (GTI). Considering the importance of GTI, widespread recognition of them seems necessary. we aimed to characterize and compare semen microbial populations in fertile and infertile men who referred to an infertility clinic in Yazd, Iran.
Methods:
Semen samples were collected from two groups of fertile (268) and infertile (210) men. Sperm analysis (concentration, morphology, viability and motility parameters) were performed according to the World Health Organization (WHO) 2010 guidelines laboratory manual. Bacterial isolation was performed in Sheep Blood Agar and Eosin Methylene Blue (EMB) agar plates. For PCR, samples were analyzed with genus specific primers.
Results:
All semen characteristics were poor in the infertile group compared to those in the fertile men (p-value< 0.05). Enterococcus spp. (18.7%, 17.1%; p= 0.814), E. coli (7.9%, 11.4%; p= 0.486), Staphylococcus aureus (6.4%, 2.9%; p= 0.398) and Proteus mirabilis (0%, 2.9%; p= 0.002) were the most common agents, respectively. Also, the results obtained from PCR were confirmed using culture-base method.
Conclusion:
Proteus mirabilis contamination was identified in the infertile group. While no significant association was observed between male infertility and semen microbial populations, p. mirabilis may be the leading cause of reproduction impairment in men.
Key Words: Infertility, Microbial contamination, culture, PCR
Introduction
Male infertility is a worldwide health problem and its etiology is not well defined (1). Male infertility can be responsible for 20-30% of infertility cases that many parameters including anatomical defects, prostatitis, hormonal defects, varicocele, physiological and psychological disorders and immune defects can cause this problem (2-6). Genital tract infection (GTI) has been suggested as one of the harmful causes for male fertility (7, 8).
It is believed that contaminations may exert negative effects on spermatogenesis process or decrease semen quality and sperm function. Scientific reports suggests that the mechanism of contamination process on male reproductive tract and fertility potential are related to sperm agglutination, sperm immobilization, sperm DNA fragmentation[by increasing in reactive oxygen species (ROS) level],induction of chronic inflammations which can lead to reductions in sperm parameters such as count, motility and morphology (9-11). However, to date the exact mechanism of microorganism actions and its effect on male fertility is not clear. Many studies showed some microorganisms including bacteria, viruses, and fungi have been isolated from seminal fluid of infertile men (12-14).
Escherichia coli were seen in semen sample of infertile men as its prevalence was higher than those detected in fertile men. Also E. coli was observed in reproductive tract disorders such as prostatitis and epididymitis (15-17). Staphylococcus aureus is another microorganism that play an important role in male reproductive tract infection (18). Many studies showed S. aureus is one of the most common bacterium isolated from the seminal fluid of infertile men (12, 18, 19).Nabi et al in 2013evaluated bacterial contamination in seminal fluid of male partners in recurrent abortion cases. They reported, S. aureus and E. coli were the two main bacteria in the seminal fluid of male partners of women with unexplained recurrent abortion (20). Chlamydia trachomatis is another bacterium found in prostatitis, epididymitis, and urethritis cases. A systematic review in 2016 by Ahmadi et al, pointed to Chlamydia trachomatis as a very important and prevalent pathogen in infertile men as its prevalence was significantly higher than those in fertile men (21).
Baud et al (2019) compared the bacterial composition in 26 normal and 68 abnormal spermiogram parameters using PCR technique. They reported that overall sperm bacterial content didn’t play a major role in male infertility (22). The novelty of our study compared to previous studies was to evaluate bacterial contamination semen with blood agar and PCR methods in the high population of fertile and infertile men. There are very limited studies regarding the microbial contaminations in seminal fluid of infertile men in Iran. Since geographic parameters, genetic history and hygiene conditions are contributing factors for prevalence of microorganisms in a population, we aimed to characterize and compare seminal microbial status in the fertile and infertile males referring to Yazd infertility research center and find out which of the two methods blood agar and PCR assay is more suitable semen bacterial contamination.
Materials and Methods
Study population
In this case-control study, a total of 478 volunteer men who referred to Yazd infertility research center from September 2015 to July 2016 were divided into two groups of Fertile (n; 268) and Infertile (n; 210) males. Diagnosis of fertility or infertility were done by an urologist according to the World Health Organization (WHO) 2010 guidelines (23). Inclusion criteria included; Fertile and infertile men identified by the Andrology Laboratory. Exclusion criteria included infectious diseases sufferers and antibiotics usage of at least two weeks prior to semen collection, exposure to chemotherapeutics or radiation, testis trauma, smokers and variciselectomy. The ethical committee based at the Yazd infertility research center approved the study protocol and use of patients’ information. Also, all participants read and signed an informed consent.
Sperm collection and analysis
Semen specimens were collected in sterile container, the abstinence period for all participants was 2-5 days. Semen analysis was carried out according to the world health organization (WHO) laboratory manual for the examination and processing of human semen (Organization, 2010). Following masturbation induced ejaculation and were liquefied at 37 °C for 30 minutes. Sperm analysis including count and motility parameters (e.g., progressive, non-progressive and immotile) were assessed by Mackler chamber. Papanicolaou and Eosin-Nigrosin staining tests were done for sperm morphology and sperm viability evaluation, respectively (24).
Microorganism identification
Homogenized semen samples were cultured on the sheep blood agar and eosin methylene blue agar (EMB) (Condapronadisa, Spain) to isolation of gram positive and negative bacteria, respectively. Differential tests were done for phenotypic identification of the species; Bile Esculin Agar (BEA), growth in 6.5% NaCl, catalase and hemolysis tests. Mannitol salt agar (MSA), DNase agar, coagulase and catalase tests were carried out for identification of Staphylococcus species. Differential tests were used for characterization of Gram-negative bacteria which included: catalase, oxidase, Simmons citrate agar, methyl red– voges-proskauer (MR-VP), lysine decarboxylase, triple sugar iron (TSI), and sulfide-indol-motility (SIM).
PCR reactions were performed for detection of various grown colonies (Table 1). Chromosomal DNA was extracted from the pure colonies using the Qiagen extraction kit (QIAamp DNA mini kit, USA). The DNA concentration and purity was assessed using a Nanodrop ND-1000 spectrophotometer (Thermo Fisher Scientific, UK) and 1% gel electrophoresis, respectively. Templet DNA was kept at -20 °C until more use. The primer sequences, PCR compounds and reactions are listed in Table 1. In general, PCR was performed in a final volume of 25 μl in an Eppendorf Master Cycle Gradient thermocycler (Eppendorf, Hamburg, Germany). PCR products were subjected to a 1% agarose/0.5×TBE gel electrophorese (45 mM-Tris-borate, 1 mM-EDTA) stained with 0.1 μl/ml Gel Red™ (Biotium, USA), then photographed under an UV trans-illuminator (Tanon, China).
Table 1.
The primer sequences, PCR compounds and reactions.
| Gene target | Primer sequences | Reaction compounds | PCR program | Ref |
|---|---|---|---|---|
| Staphylococcus spp. | F: CAGGAGAAGTTAAAGAACAAGAAG | 1.0 µL of template DNA, 12.1 µL of CinnaGen PCR Master Mix, 0.8 µL of each primer, and 10.3 µL of ddH2O. | initial denaturation at 94 °C for 5 min, denaturation at 95 °C for 30 s, annealing at 56 °C for 60 s, extension at 72 °C for 60 s and a final extension at 72 °C for 5 min. | (25) |
| R: GTGAACGAACTAATTGAGATACG | ||||
| Enterococcus spp. | F: AGAGAGTAAGGTCCGATTGAAC | 0.9 µL of template DNA, 10.6 µL of CinnaGen PCR Master Mix, 1.0 µL of each primer, and 11.5 µL of ddH2O | initial denaturation at 95 °C for 5 min, denaturation at 94 °C for 45 s, annealing at 55 °C for 50 s, extension at 72 °C for 60 s and a final extension at 72 °C for 6 min. | |
| R: GGTTGTTTCCCGTATTATGC | ||||
| Pseudomons aeruginosa | F: GCCTCTACCAGTACCTGCTAC | 0.8 µL of template DNA, 11.6 µL of CinnaGen PCR Master Mix, 1.0 µL of each primer, and 10.6 µL of ddH2O. | initial denaturation at 95 °C for 5 min, denaturation at 95 °C for 55 s, annealing at 56 °C for 45 s, extension at 72 °C for 60 s and a final extension at 72 °C for 5 min. | |
| R: AATAGAACAGCTCCAGCAGG | ||||
| 16s rRNA | F: AGAGTTTGATCMTGGCTCAG | 1.0 µL of template DNA, 12.5 µL of CinnaGen PCR Master Mix, 1.0 µL of each primer, and 9.5 µL of ddH2O. | initial denaturation at 95 °C for 6 min, denaturation at 95 °C for 50 s, annealing at 53 °C for 45 s, extension at 72 °C for 50 s and a final extension at 72 °C for 10 min. | |
| R: ACGGCTACCTTGTTACGACTT | ||||
| Streptococcus spp. | F: AGA GTT TGA TCC TGG CTC AG | 1.0 µL of template DNA, 12.3 µL of CinnaGen PCR Master Mix, 0.9 µL of each primer, and 9.9 µL of ddH2O. | initial denaturation at 95 °C for 6 min, denaturation at 94 °C for 55 s, annealing at 57 °C for 50 s, extension at 72 °C for 60 s and a final extension at 72 °C for 5 min. | |
| R: GTA CCG TCA CAG TAT GAA CTT TCC | ||||
| Escherchia. coli | F: 5′ TTGAAAATGGTCTGCTGCTG 3′ | 0.9 µL of template DNA, 12.2 µL of CinnaGen PCR Master Mix, 0.8 µL of each primer, and 10.3 µL of ddH2O. | initial denaturation at 94 °C for 5 min, denaturation at 95 °C for 45 s, annealing at 55 °C for 60 s, extension at 72 °C for 60 s and a final extension at 72 °C for 10 min. | (26) |
| R: 5′ TATTGGCTTCATCCACCACA 3 | ||||
| Klebsiella pneumonia | F: ATTTGAAGAGGTTGCAAACGAT | 1.0 µL of template DNA, 13.2 µL of CinnaGen PCR Master Mix, 1.0 µL of each primer, and 8.8 µL of ddH2O. | initial denaturation at 94 °C for 3 min, denaturation at 95 °C for 30 s, annealing at 56 °C for 60 s, extension at 72 °C for 60 s and a final extension at 72 °C for 9 min. | (27) |
| R: TTCACTCTGAAGTTTTCTTGTGTTC | ||||
| Citrobacter koseri | F: 5-TTAATCATAGACTGCGAGTG-3 | 1.5 µL of template DNA, 12.5 µL of CinnaGen PCR Master Mix, 1.0 µL of each primer, and 9.0 µL of ddH2O. | initial denaturation at 94 °C for 3 min, denaturation at 95 °C for 30 s, annealing at 58 °C for 60 s, extension at 72 °C for 60 s and a final extension at 72 °C for 9 min. | (28) |
| R: 5- ATGAGAAACGAGGAAGTCAT-3 | ||||
| Klebsiella oxytoca | F: 5-GGACTACGCCGTCTATCGTCAAG-3 | 1.8 µL of template DNA, 13.5 µL of CinnaGen PCR Master Mix, 1.0 µL of each primer, and 7.7 µL of ddH2O. | initial denaturation at 94 °C for 5 min, denaturation at 95 °C for 35 s, annealing at 56 °C for 45 s, extension at 72 °C for 60 s and a final extension at 72 °C for 9 min. | (29) |
| R: 5- TAGCCTTTATCAAGCGGATACTGG -3 | ||||
| Diphtheroids | F: 5- ACCGCACTTTAGTGTGTGTG-3 | 1.1 µL of template DNA, 12.3 µL of CinnaGen PCR Master Mix, 1.0 µL of each primer, and 9.3 µL of ddH2O. | initial denaturation at 94 °C for 5 min, denaturation at 94 °C for 30 s, annealing at 55 °C for 50 s, extension at 72 °C for 60 s and a final extension at 72 °C for 9 min. | (30) |
| R;5- TCTCTACGCCGATCTTGTAT-3 | ||||
| Yeasts | F: 5- CTGGCTTGGTGTATGT -3 | 1.0 µL of template DNA, 13.2 µL of CinnaGen PCR Master Mix, 1.0 µL of each primer, and 8.8 µL of ddH2O. | initial denaturation at 94 °C for 3 min, denaturation at 95 °C for 30 s, annealing at 56 °C for 60 s, extension at 72 °C for 60 s and a final extension at 72 °C for 9 min. | (31) |
| R: 5- CTGGCTTGCTACATAC-3 | ||||
| Proteus mirabilis | F: 5-AGAGTTTGATCCTGGCTCAG-3 | 0.8 µL of template DNA, 11.8 µL of CinnaGen PCR Master Mix, 0.9 µL of each primer, and 9.4 µL of ddH2O. | initial denaturation at 94 °C for 6 min, denaturation at 95 °C for 33 s, annealing at 56 °C for 32 s, extension at 72 °C for 60 s and a final extension at 72 °C for 10 min. | (32) |
| R: 5- CTACGGCTACCTTGTTACGA-3 |
Statistical analysis
The statistical package for social science (SPSS) software version 20 (IBM Co., Illinois, USA) was used for statistical analysis of data. Student’s t-test and proportional test were performed for numerical variables and categorical variables, respectively. Results were presented as Mean±SD or frequency percentage. A statistically significant difference was considered when p value was less than 0.05.
Results
The mean age for the fertile and infertile groups was 36.3±4.2 and 34.6±3.8 years, respectively. Sperm analysis in both groupwereshown in Table 2. The mean semen volume and sperm count as well as mean frequencies of sperm normal morphology, viability and motility (progressive and non-progressive motility) were significantly lower in infertile individuals compared to fertile (for all, p-value≤ 0.0001).
Table 2.
Comparisons of the sperm characteristics in the fertile and infertile groups.
| Groups | Semen Volume (ml) | Sperm Count (millions/ml) | Sperm Normal Morphology (%) | Progressive Motility (%) | Non-progressive Motility (%) | Immotile (%) | Viability(%) |
|---|---|---|---|---|---|---|---|
| Fertile (no. 268) | 3.0±1.1 | 72.0± 45.2 | 4.9±3.9 | 42.1±9.4 | 10.4±3.9 | 47.5±8.9 | 67.2±7.6 |
| Infertile (no. 210) | 2.0±1.0 | 10.2± 0.4 | 2.1±1.8 | 12.8±8.5 | 6.3±4.7 | 80.9±9.4 | 36.4±8.2 |
| p value | <0.0001* | <0.0001* | <0.0001* | <0.0001* | <0.0001* | <0.0001* | <0.0001* |
The data were presented as mean±SD
p-value≤ 0.05 was considered as significant between fertile and infertile groups.
Bacterial culture showed contamination with various species in 36.5% and 34.3% of fertile and infertile samples, respectively (Table 3). Enterococcus and E. coli were respectively the most common agents identified in both groups. Also, other isolated microorganisms including Klebsiella pneumonia (1.4%), Citrobacterkoseri (0.6%), Streptococcus spp. (0.6%), Klebsiellaoxytoca (0.3%), Diphtheroids (0.3%) and yeasts (0.3%), had very low prevalence in the semen of fertile men.
Table 3.
Phenotypic identification of semen microbial contaminations in fertile and infertile groups.
| Bacterium | Fertile (no. 268) | Infertile (no. 210) | p value | ||
|---|---|---|---|---|---|
| None | 169 (63.5%) | 138 (65.7%) | 0.813 | ||
| Enterococcus spp. | 50 | (18.7%) | 36 | (17.1%) | 0.814 |
| E. coli | 21 | (7.9%) | 24 | (11.4%) | 0.486 |
| Staphylococcus aureus | 17 | (6.4%) | 6 | (2.9%) | 0.398 |
| Klebsiella pneumonia | 4 | (1.4%) | 0 | (0%) | 0.460 |
| Citrobacterkoseri | 2 | (0.6%) | 0 | (0%) | 0.642 |
| Streptococcus spp. | 2 | (0.6%) | 0 | (0%) | 0.642 |
| Yeast | 1 | (0.3%) | 0 | (0%) | 0.742 |
| Diphtheroid | 1 | (0.3%) | 0 | (0%) | 0.742 |
| Klebsiellaoxytoca | 1 | (0.3%) | 0 | (0%) | 0.742 |
| Proteus mirabilis | 0 | (0%) | 6 | (2.9%) | 0.002* |
p-value≤ 0.05 was considered as significant between fertile and infertile groups.
Proteus mirabilis (n; 6 of 210, 2.8%) were identified only in infertile patients. There was no significant difference in distribution of different microorganisms between the fertile and infertile groups. PCR using specific primers revealed various microorganisms in 36.6% and 45.7% of the fertile and infertile groups, respectively (Table 4).
Table 4.
Molecular diagnosis of semen microbial load in fertile and infertile groups.
| Bacterium | Fertile (no. 268) | Infertile (no. 210) | p value | ||
|---|---|---|---|---|---|
| None | 168 (63.4%) | 114 (54.3%) | 0.291 | ||
| Enterococcus spp. | 51 | (19.4%) | 42 | (20.0%) | 0.930 |
| E. coli | 23 | (8.9%) | 36 | (17.1%) | 0.119 |
| Staphylococcus aureus | 13 | (4.9%) | 6 | (2.9%) | 0.584 |
| Klebsiella pneumonia | 4 | (1.5%) | 6 | (2.9%) | 0.563 |
| Citrobacterkoseri | 2 | (0.6%) | 0 | (0%) | 0.642 |
| Streptococcus spp. | 3 | (0.9%) | 0 | (0%) | 0.568 |
| Yeast | 1 | (0.3%) | 0 | (0%) | 0.742 |
| Diphtheroid | 1 | (0.3%) | 0 | (0%) | 0.742 |
| Klebsiellaoxytoca | 1 | (0.3%) | 0 | (0%) | 0.742 |
| Proteus mirabilis | 0 | (0%) | 6 | (2.9%) | 0.002* |
| Candida spp. | 1 | (0.3%) | 0 | (0%) | 0.742 |
p-value ≤ 0.05 was considered as significant between fertile and infertile groups.
In line with culture-base method, PCR showed that Enterococcus and E. coli were the most common agents in the semen collected from both fertile and infertile men. Molecular characterization showed no significant difference in distribution of different microorganisms between the fertile and infertile groups. According to the culture results, all 6 samples were positive for P. mirabilis in PCR(p-value= 0.002). Candida spp. (0.3%) was isolated only from semen samples of fertile men.
Discussion
In the preset study, we isolated different microorganisms from seminal fluid of fertile and infertile men. Our results similar to Baud et al, study indicated that there was no significant difference in the prevalence of identified microorganisms between the fertile and infertile males (1). This data was contrast with other studies that shown the prevalence of microorganism in the semen of the infertile was significantly higher than the fertile group and it may be correlated with sperm quality in infertile men (33).
Enterococcus faecalis was commonly isolated from the seminal fluids as it was the most abundant bacterium. However, the prevalence of E. faecalis was not significantly different between fertile and infertile men. Similar to our funding, Vilvanathan et al in 2016 assessed the presence of bacteria in the seminal sample of infertile men. They reported isolation of E. faecalis from 30 % of seminal fluid samples which was the first common organism in the infertile group (12). Also, Machen et al in 2018 and Filipiak et al in 2015 reported E. faecalis as the second most common bacterium isolated from infertile human semen samples (19, 34). Recently in 2019,Carda-Dieguezet al proposed that the source of Enterococcus contamination in seminal fluid may well be infection in female vagina or urethra (35).
Escherichia coli is another common bacterium isolated from semen samples (36, 37). There is controversy in scientific reports regarding relation between the presence of E. coli in the semen sample and prevalence of male infertility (38, 39). However, there seems to be a positive relation between presence of E. coli and acute epididymitis and prostatitis (40, 41).
In a recent study (2018), assessment of microorganisms such as E. coli was evaluated in infertile Nigerian patients. The investigators reported that E. coli was not only a prevalent organism in the seminal fluid of infertile men, but there seems to be a significant relation between its presence and decrease in sperm parameters including sperm count, motility and morphology (14).Although, E. coli was the second most prevalent bacteria in the semen of infertile men, its prevalence was not significantly different compared to the fertile group. Similar to our finding, Filipiak et al reported no statistically significant association between 41 and other facultative anerobic bacteria with male infertility (42).
Nabi et al.in 2013reportedS. Aureus to be the main microorganism in the semen culture of men with history of at least two recurrent miscarriages (20). Additionally, Momoh et al noted S. Aureus as the most prevalent bacterium isolated from 75% of infertile seminal fluid (43). Kaur et al in 2010 demonstrated that co-incubation of human spermatozoa with S. aureus led to decreased sperm parameters including count, motility, morphology and increased agglutination (44). In the present study, we found this bacterium to be the third most common microorganism in the semen of both fertile and infertile men. Importantly, the frequency distribution of S. Aureus in the infertile group was insignificantly lower than that in the fertile group. This observation casts doubt on the role of S. Aureus in male infertility.
We also isolated other microorganisms including Klebsiella pneumonia, Klebsiellaoxytoca, Citrobacterkoseri, Streptococcus spp., Diphtheroids, and yeasts, with very low incidence in the semen of fertile men. Due to lack of supporting evidence, the possibility of implication of these microorganisms in male infertility cannot be discussed at the present time. However, Proteus mirabilis was isolated in six cases of semen culture from infertile men. Similar to our results, Elgozali et al in 2015 also isolated Proteus species from semen of infertile man (45). Mehta et al observed Proteus species in the semen of men with Oligo asthenoterato spermia (46). Therefore, p. mirabilis might be implicated in male infertility, though this hypothesis needs further confirmatory studies.
The results of present study didn’t show any significant association between male infertility and microbial populations isolated from semen samples. E. faecalis, E. coli, S. aureus and Klebsiella pneumonia were the most prevalent bacteria in the semen of fertile and infertile men, respectively. However, p. mirabilis was detected in the semen of infertile men which may be responsible for lack of reproductive ability. However, much more studies are essential to confirm this inference.
Acknowledgements
This study was approved by the Ethics Committee of Iran University of Medical Sciences (IR.IUMS.FMD.REC13969323133001).
The authors declare that they have no conflicts of interests.
References
- 1.Gimenes F, Souza C, Bento JC, Teixeira JJ, Maria-Engler SS, Bonini MG, et al. Male infertility: a public health issue caused by sexually transmitted pathogens. Nat Rev Urol. 2014;11(12):672, 87. doi: 10.1038/nrurol.2014.285. [DOI] [PubMed] [Google Scholar]
- 2.Park YE, Kim TO. Sexual dysfunction and Fertility Problems in Men with Inflammatory Bowel Disease. World J Mens Health. 2020;38(3):285, 297. doi: 10.5534/wjmh.190007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Moein MR, Ghasemzadeh J, Pourmasoumi S. Evaluation of sperm retrieval rate with bilateral testicular sperm extraction in infertile patients with azoospermia. Iran J Reprod Med. 2015;13(11):711, 714. [PMC free article] [PubMed] [Google Scholar]
- 4.Dubey CK, Sharma A, Khinchi M. A Review on Common Factors Affecting a Semen Quality of Male. Asian Journal of Pharmaceutical Research and Development. 2017;5(4):1, 19. [Google Scholar]
- 5.Rezakhaniha B, Heidari R, Abbasi M. Can Melissa officinalis improve chromatin structure and sperm parameters in a rat model of varicocele? Andrologia. 2018;50(8):e13058. doi: 10.1111/and.13058. [DOI] [PubMed] [Google Scholar]
- 6.REZA KB, Arianpour N, Sirousbakht S. Effect of cystoscopy on prostate-specific antigen, new words about old subject. 2010;4(3):193, 198. [Google Scholar]
- 7.Moragianni D, Dryllis G, Andromidas P, Kapeta-Korkouli R, Kouskounit E, Pessach I, et al. Genital tract infection and associated factors affect the reproductive outcome in fertile females and females undergoing in vitro fertilization. Biomed Rep. 2019;10(4):231, 237. doi: 10.3892/br.2019.1194. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Naz M, Kamal M. Classification, causes, diagnosis and treatment of male infertility: a review. Oriental pharmacy and experimental medicine. 2017;17(2):89, 109. [Google Scholar]
- 9.Sellami H, Znazen A, Sellami A, Mnif H, Louati N, Ben Zarrouk S, et al. Molecular detection of Chlamydia trachomatis and other sexually transmitted bacteria in semen of male partners of infertile couples in Tunisia: the effect on semen parameters and spermatozoa apoptosis markers. PLoS One. 2014;9(7):e98903. doi: 10.1371/journal.pone.0098903. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Pourmasumi S, Sabeti P, Rahiminia T, Mangoli E, Tabibnejad N, Talebi AR. The etiologies of DNA abnormalities in male infertility: An assessment and review. Int J Reprod Biomed. 2017;15(6):331–344. [PMC free article] [PubMed] [Google Scholar]
- 11.Liu X, Chen G, He X. Sperm DNA damage is not related to seminal leukocyte subsets in infertile males with asymptomatic genital tract infection. Zhonghua nan ke xue. 2018;24(1):45–49. [PubMed] [Google Scholar]
- 12.Vilvanathan S, Kandasamy B, Jayachandran AL, Sathiyanarayanan S, Tanjore Singaravelu V, Krishnamurthy V, et al. Bacteriospermia and Its Impact on Basic Semen Parameters among Infertile Men. Interdiscip Perspect Infect Dis. 2016;2016:2614692. doi: 10.1155/2016/2614692. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Tiwari S, Pattanaik S. Bacteriological Profile and Seminal Fluid Analysis of Men Attending Infertility Clinic of A Teaching Hospital: A Study From Eastern India. Nepal Med Coll J. 2016;18(1-2):74–77. [Google Scholar]
- 14.Nasir A, Agbo E, Sani M. Assessment of microbiological quality of male patients with infertility at Murtala Muhammad specialist hospital kano, Nigeria. MOJ Bioequiv Availab. 2018;5(3):170–4. [Google Scholar]
- 15.Kaur K, Prabha V. Spermagglutinating Escherichia coli and its role in infertility: in vivo study. Microb Pathog. 2014;70:33–8. doi: 10.1016/j.micpath.2014.03.010. [DOI] [PubMed] [Google Scholar]
- 16.Solomon M, Henkel R. Semen culture and the assessment of genitourinary tract infections. Indian J Urol. 2017;33(3):188–193. doi: 10.4103/iju.IJU_407_16. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Almeida F, Santos Silva A, Silva Pinto A, Sarmento A. Chronic prostatitis caused by extended-spectrum beta-lactamase-producing Escherichia coli managed using oral fosfomycin-A case report: IDCases. 2019;15:e00493. doi: 10.1016/j.idcr.2019.e00493. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Li J, Li B, Song J, Liu H, Bi W, Dong G, et al. Characteristic and mechanism of immobilization effect of Staphylococcus aureus on human spermatozoa. Microbial pathogenesis. 2018;119:28–34. doi: 10.1016/j.micpath.2018.03.049. [DOI] [PubMed] [Google Scholar]
- 19.Machen GL, Bird ET, Brown ML, Ingalsbe DA, East MM, Reyes M, et al., editors. Time trends for bacterial species and resistance patterns in semen in patients undergoing evaluation for male infertility. Proc (Bayl Univ Med Cent). 2018;31(2):165–167. doi: 10.1080/08998280.2018.1444298. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Nabi A, Khalili MA, Halvaei I, Ghasemzadeh J, Zare E. Seminal bacterial contaminations: Probable factor in unexplained recurrent pregnancy loss. Iran J Reprod Med. 2013;11(11):925–932. [PMC free article] [PubMed] [Google Scholar]
- 21.Ahmadi MH, Mirsalehian A, Bahador A. Association of Chlamydia trachomatis with infertility and clinical manifestations: a systematic review and meta-analysis of case-control studies. Infect Dis (Lond). 2016;48(7):517–23. doi: 10.3109/23744235.2016.1160421. [DOI] [PubMed] [Google Scholar]
- 22.Baud D, Pattaroni C, Vulliemoz N, Castella V, Marsland B, Stojanov M. Sperm microbiota and its impact on semen parameters. Front Microbiol. 2019;10:234. doi: 10.3389/fmicb.2019.00234. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. WHO laboratory manual for the examination and processing of human semen. 2010. Organization WH. [PubMed]
- 24.Nabi A, Khalili M, Halvaei I, Roodbari F. Prolonged incubation of processed human spermatozoa will increase DNA fragmentation. Andrologia. 2014;46(4):374–9. doi: 10.1111/and.12088. [DOI] [PubMed] [Google Scholar]
- 25.Fazzeli H, Arabestani MR, Esfahani BN, Khorvash F, Pourshafie MR, Moghim S, et al. A new multiplex polymerase chain reaction assay for the identification a panel of bacteria involved in bacteremia. Adv Biomed Res. 2013;2:7. doi: 10.4103/2277-9175.107972. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Molina F, López-Acedo E, Tabla R, Roa I, Gómez A, Rebollo JE, editors. Improved detection of Escherichia coli and coliform bacteria by multiplex PCR. BMC biotechnology. 2015;15(1):48. doi: 10.1186/s12896-015-0168-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Turton JF, Perry C, Elgohari S, Hampton CV. PCR characterization and typing of Klebsiella pneumoniae using capsular type-specific, variable number tandem repeat and virulence gene targets. J Med Microbiol. 2010;59(Pt 5):541–547. doi: 10.1099/jmm.0.015198-0. [DOI] [PubMed] [Google Scholar]
- 28.Underwood S, Avison MB. Citrobacter koseri and Citrobacter amalonaticus isolates carry highly divergent β-lactamase genes despite having high levels of biochemical similarity and 16S rRNA sequence homology. J Antimicrob Chemother. 2004;53(6):1076–80. doi: 10.1093/jac/dkh235. [DOI] [PubMed] [Google Scholar]
- 29.Kovtunovych G, Lytvynenko T, Negrutska V, Lar O, Brisse S, Kozyrovska N. Identification of Klebsiella oxytoca using a specific PCR assay targeting the polygalacturonase pehX gene. Res Microbiol. 2003;154(8):587–92. doi: 10.1016/S0923-2508(03)00148-7. [DOI] [PubMed] [Google Scholar]
- 30.Torres LdFC, Ribeiro D, Hirata Jr R, Pacheco LGC, Souza MC, Santos LSd, et al. Multiplex polymerase chain reaction to identify and determine the toxigenicity of Corynebacterium spp with zoonotic potential and an overview of human and animal infections. Mem Inst Oswaldo Cruz. 2013;108(3):272–279. doi: 10.1590/S0074-02762013000300003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.de Barros Lopes M, Soden A, Martens AL, Henschke PA, Langridge P. Differentiation and species identification of yeasts using PCR. Int J Syst Bacteriol. 1998;48(Pt 1):279–86. doi: 10.1099/00207713-48-1-279. [DOI] [PubMed] [Google Scholar]
- 32.Mukhtar AA, Abd Alfadil NA, Mohamed MS, Altayb HN, Elzak SG, Hassan MS, editors. Identification of Proteus mirabilis on banknotes using 16s rRNA gene in Khartoum State. Sudan Journal of Medical Sciences. 2018;13(3):175–86. [Google Scholar]
- 33.Motamedifar M, Malekzadegan Y, Namdari P, Dehghani B, Jahromi BN, Sarvari J. The prevalence of bacteriospermia in infertile men and association with semen quality in Southwestern Iran. Infect Disord Drug Targets. 2020;20(2):198–202. doi: 10.2174/1871526519666181123182116. [DOI] [PubMed] [Google Scholar]
- 34.Filipiak E, Marchlewska K, Oszukowska E, Walczak‐Jedrzejowska R, Swierczynska‐Cieplucha A, Kula K, et al. Presence of aerobic micro‐organisms and their influence on basic semen parameters in infertile men. Andrologia. 2015;47(7):826–31. doi: 10.1111/and.12338. [DOI] [PubMed] [Google Scholar]
- 35.Carda-Dieguez M, Cardenas N, Aparicio M, Beltran D, Rodriguez JM, Mira A. Variations in Vaginal, Penile, and Oral Microbiota After Sexual Intercourse: A Case Report. Front Med (Lausanne). 2019;6:178. doi: 10.3389/fmed.2019.00178. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Boguen R, Treulen F, Uribe P, Villegas JV. Ability of Escherichia coli to produce hemolysis leads to a greater pathogenic effect on human sperm. Fertil Steril. 2015;103(5):1155–61. doi: 10.1016/j.fertnstert.2015.01.044. [DOI] [PubMed] [Google Scholar]
- 37.Motrich RD, Salazar FC, Breser ML, Mackern-Oberti JP, Godoy GJ, Olivera C, et al. Implications of prostate inflammation on male fertility. Andrologia. 2018;50(11):e13093. doi: 10.1111/and.13093. [DOI] [PubMed] [Google Scholar]
- 38.Biswas B, Bhushan S, Rajesh A, Suraj S, Lu Y, Meinhardt A, et al. Uropathogenic Escherichia coli (UPEC) induced antimicrobial gene expression in the male reproductive tract of rat: evaluation of the potential of Defensin 21 to limit infection. Andrology. 2015;3(2):368–75. doi: 10.1111/andr.12012. [DOI] [PubMed] [Google Scholar]
- 39.Mashaly M, Masallat D, Elkholy A, Abdel‐Hamid I, Mostafa T, editors. Seminal Corynebacterium strains in infertile men with and without leucocytospermia. Andrologia. 2016;48(3):355–9. doi: 10.1111/and.12457. [DOI] [PubMed] [Google Scholar]
- 40.Fraczek M, Hryhorowicz M, Gaczarzewicz D, Szumala-Kakol S, Kolanowski TJ, Beutin L, et al. Can apoptosis and necrosis coexist in ejaculated human spermatozoa during in vitro semen bacterial infection? Journal of assisted reproduction and genetics. 2015;32(5):771–779. doi: 10.1007/s10815-015-0462-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Bhushan S, Hossain H, Lu Y, Geisler A, Tchatalbachev S, Mikulski Z, et al. Uropathogenic E. coli induce different immune response in testicular and peritoneal macrophages: implications for testicular immune privilege. PLoS One. 2011;6(12):e28452. doi: 10.1371/journal.pone.0028452. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Filipiak E, Marchlewska K, Oszukowska E, Walczak-Jedrzejowska R, Swierczynska-Cieplucha A, Kula K, et al. Presence of aerobic micro-organisms and their influence on basic semen parameters in infertile men. Andrologia. 2015;47(7):826–31. doi: 10.1111/and.12338. [DOI] [PubMed] [Google Scholar]
- 43.Momoh A, Idonije B, Nwoke E, Osifo U, Okhai O, Omoroguiwa A, et al., editors. Pathogenic bacteria-a probable cause of primary infertility among couples in Ekpoma. Journal of Microbiology and Biotechnology Research. 2011;1(3):66–71. [Google Scholar]
- 44.Kaur S, Prabha V, Shukla G, Sarwal A. Interference of human spermatozoa motility by live Staphylococcus aureus. Am J Biomed Sci. 2010;2(1):91–7. [Google Scholar]
- 45.Elgozali SM, Al Fadhil AO, Adam AA. Pyospermia and Bacteriospermia among Infertile Married Men attending Fertility Centers in Khartoum State, Sudan. American Journal of Research Communication. 2015;3(2):43–9. [Google Scholar]
- 46.Mehta R, Sridhar H, Kumar BV, Kumar TA. High incidence of oligozoospermia and teratozoospermia in human semen infected with the aerobic bacterium Streptococcus faecalis. Reprod Biomed Online. 2002;5(1):17–21. doi: 10.1016/s1472-6483(10)61591-x. [DOI] [PubMed] [Google Scholar]
