TABLE 5.
Frequency and distribution of dinucleotide repeat tract instability events in wild-type, rad27, and msh2 strainsa
| Strain genotype | Instability
|
Tracts sequenced | No. of tracts with indicated bp change
|
||||||
|---|---|---|---|---|---|---|---|---|---|
| Avg (individual expt) (10−5) | Relative | +2 | −2 | +4 | −14 | +14 | Other | ||
| Wild type | 2.5 (3.0, 2.3, 2.0) | 1.0 | 11 | 9 | 1 | 1 | 0 | 0 | 0 |
| msh2Δ::hisG | 660 (880, 600, 500) | 264 | 28 | 7 | 21 | 0 | 0 | 0 | 0 |
| rad27Δ::HIS3 | 4,600 (1,000, 7,000, 5,800, 4,600) | 1,800 | 35 | 29 | 0 | 5 | 1 | 0 | 0 |
| rad27-G67S | 290 (390, 340, 210, 220) | 116 | 19 | 16 | 0 | 3 | 0 | 0 | 0 |
| rad27-G240D | 58 (74, 58, 43) | 23 | 20 | 17 | 0 | 0 | 0 | 1 | 2b |
Wild-type (FY23), msh2Δ::hisG (EAY281), rad27Δ::HIS3 (EAY615), rad27-G67S (EAY607), and rad27-G240D (EAY611) strains were tested in the 5-FOA resistance assay as described in Materials and Methods. In each experiment 11 independent colonies were tested. The average median frequency in each assay relative to the wild-type frequency is presented. The distribution in base pairs of insertions and deletions in the repeat tract is shown. DNA sequencing was performed on plasmids derived from the following 5-FOA-resistant strains containing pSH44 or a derivative plasmid: wild-type (FY23) (57), msh2Δ (24), rad27Δ (23), rad27-G67S (EAY756 [this study]), and rad27-G240D (EAY757 [this study]) (24) strains.
For both events, a 19-bp duplication ([CA]16 TGTCGACGATCCCCTGGCAAAACGACGATCCCCTGGCAAAACGACGATCTTCTTAG) occurred in the sequence immediately following the GT repeat. The duplicated sequence is in boldface, and the microhomology flanking the duplication is underlined.