Skip to main content
. 2021 Dec 28;25(1):103702. doi: 10.1016/j.isci.2021.103702
REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies
Alexa Fluor 555 conjugated goat anti-rabbit Thermo Fisher Scientific Cat: #A21428; RRID: AB_2535849
HRP-conjugated goat anti-mouse IgG secondary antibody Thermo Fisher Scientific Cat: #31430;
RRID: AB_228307
HRP-conjugated goat anti-rabbit IgG secondary antibody Thermo Fisher Scientific Cat: #31460;
RRID: AB_228341
Mouse monoclonal anti-Elav 9F8A9 Developmental Studies Hybridoma Bank Cat: #ELAV 9F8A9; RRID: AB_2314364
Mouse monoclonal anti-Gypsy envelope Song et al., 1994 RRID: AB_2569690
Mouse monoclonal anti-Histone H3K9me3 Active Motif Cat: #61013;
RRID: AB_2687870
Mouse monoclonal anti-Repo 8D12 Developmental Studies Hybridoma Bank Cat: #8D12;
RRID: AB_528448
Rabbit polyclonal anti-Giotto Giansanti et al., 2006 RRID: AB_2892585
Rabbit polyclonal anti-γH2AV Rockland Immunochemicals Cat: #600401914; RRID: AB_828383
Chemicals, peptides, and recombinant proteins
Blue Dye N.1 Sigma-Aldrich Cat: #861146;
CAS: 3844-45-9
DAPI Sigma-Aldrich Cat: #D9542;
CAS: 28718-90-3
Lamivudine Sigma-Aldrich Cat: #PHR-1365;
CAS: 134678-17-4
TOTO3-Iodide Invitrogen Cat: #T3604;
CAS: 166196-17-4
Zidovudine Sigma-Aldrich Cat: #PHR-1292;
CAS: 30516-87-1
X-Gal Sigma-Aldrich Cat: #B4252;
CAS: 7240-90-6
Critical commercial assays
iQ multiplex powermix Bio-Rad Cat: #1725849
NucleoSpin™ Gel and PCR clean-up Kit Macherey-Nagel Cat: #740609.50
Platinum Taq DNA polymerase Invitrogen Cat: #10966018
QIAquick Gel Extraction Kit Qiagen Cat: #28706X4
Quant-iT PicoGreen™ dsDNA Assay Kit Thermo Fisher Scientific Cat: #P7589
QuantiFast SYBR green PCR Kit Qiagen Cat: #204057
SuperScript III Reverse Transcriptase Invitrogen Cat: #18080093
TaKaRa Ex Taq DNA Polymerase Takara Cat: #RR001C
Deposited data
Analysed data: see Table S1 This paper N/A
Raw data: See European Nucleotide archive under accession number PRJEB41409 This paper https://www.ebi.ac.uk/ena/browser/view/PRJEB41409
Drosophila reference genome (dm6 version) UCSC http://genome.ucsc.edu/
Experimental models: Organisms/strains
D. melanogaster: Overexpression of human Htt with 128Q under UAS control: w[1,118]; P{w[+mC]=UAS-HTT.128Q.FL}f27b Bloomington Drosophila Stock Center RRID: BDSC_33808
FlyBase: FBst0033808
D. melanogaster: Overexpression of human Htt with 16Q under UAS control: w[1,118]; P{w[+mC]=UAS-HTT.16Q.FL}F24/CyO Bloomington Drosophila Stock Center RRID: BDSC_33810
FlyBase: FBst0033810
D. melanogaster: Carries a rearrangement causing position effect variegation of the w[+] transgene marker: w[∗]/Dp(3;Y)BL2, P{w[enh]=HS-lacZ.scs}65E Bloomington Drosophila Stock Center RRID: BDSC_57371
FlyBase: FBst0057371
D. melanogaster: Expresses membrane-localized GFP under UAS control: y1 w∗; P{w+mC=UAS-mCD8::GFP.L}LL5, P{UAS-mCD8::GFP.L}2 Bloomington Drosophila Stock Center RRID: BDSC_5137
FlyBase: FBst0005137
D. melanogaster: Expresses GAL4 in neurons under elav control: P{w[+mW.hs]=GawB}elav[C155] Bloomington Drosophila Stock Center RRID: BDSC_458
FlyBase: FBst0000458
D. melanogaster: Expresses GAL4 in glia: w[1,118]; P{w[+m∗]=GAL4}repo/TM3, Sb[1] Bloomington Drosophila Stock Center RRID: BDSC_7415
FlyBase: FBst0007415
D. melanogaster: Expresses GAL4 in the eye under GMR control: w[∗]; P{w[+mC]=GAL4-ninaE.GMR}12 Bloomington Drosophila Stock Center RRID: BDSC_1104
FlyBase: FBst0001104
D. melanogaster: Expresses GAL4 pan-neuronally under nSyb control and CD8-tagged GFP under the control of UAS: w[1,118]; Pin[1]/CyO; P{y[+t7.7] w[+mC]=nSyb-GAL4.P}attP2, P{w[+mC]=UAS-mCD8::GFP.L}LL6 Bloomington Drosophila Stock Center RRID: BDSC_51944
FlyBase: FBst0051944
D. melanogaster: Overexpression of HP1a under UAS control: w[1,118]; UAS-Hp1/CyO Our lab N/A
D. melanogaster: Overexpression of Su(var)3–9-EGFP under UAS control G. Reuter Lab (Schotta and Reuter, 2000) N/A
Oligonucleotides
Primers for qRT-PCR: see Table S2 This paper; Jin et al., 2013; Preall et al., 2012; Padeken et al., 2013; Klenov et al., 2011; Lu and Clark, 2010 N/A
Primers for ChIP-qPCR: see Table S3 This paper; Papp and Müller, 2006; Wang and Elgin, 2011 N/A
Primers and probes for CNV assay: see Table S4 This paper N/A
Primers for semi-quantitative PCR: 128QHtt F: CACCGACCAAAGAAAGAACTTTCA Branco et al., 2008 N/A
Primers for semi-quantitative PCR: 128QHtt R: TTTAATTTCCTTATAGAGCTCGAGCTGTAA Branco et al., 2008 N/A
Primers for semi-quantitative PCR: gapdh F: CAGCCCCGACATGAAGGT Vanden Broeck et al., 2013 N/A
Primers for semi-quantitative PCR: gapdh R: CGATCTCGAAGTTGTCATTGATG Vanden Broeck et al., 2013 N/A
Software and algorithms
Adobe Photoshop CS6 Adobe https://www.adobe.com/products/photoshop.html
Bowtie 1.2 version Langmead et al., 2009 http://bowtie-bio.sourceforge.net/index.shtml
BWA Aligner Li and Durbin, 2009 https://emea.illumina.com/products/by-type/informatics-products/basespace-sequence-hub/apps/bwa-aligner.html
FastQC v0.11.7 version BaseSpace Labs https://emea.illumina.com/products/by-type/informatics-products/basespace-sequence-hub/apps/fastqc.html
Flynotyper Iyer et al., 2016 http://flynotyper.sourceforge.net/
GraphPad Prism 6.00 version La Jolla California USA www.graphpad.com
Mobile Element Locator Tool (MELT) 2.1.4 version Gardner et al., 2017 https://melt.igs.umaryland.edu/
Primer3 Rozen and Skaletsky, 1999 https://primer3.org/
Samtools view 1.3.1 version Li et al., 2009 http://www.htslib.org/
ZEN Software Zeiss https://www.zeiss.com/microscopy/int/products/microscope-software/zen-lite.html