TABLE 1.
Primers used for the RT-PCRa
Primer | Sequence (5′ to 3′) | Location |
---|---|---|
P1 | CCTACCTCCTTCAACTACGG | Corresponds to FMDV nt 3737–3756 |
P2 | GAAGGGCCCAGGGTTGGACTC | Complementary to FMDV nt 3955–3935 |
IRES 1 | CCTGGTCTTTCCAGGTCTAGA | Corresponds to FMDV nt 667–687 |
IRES 2 | CCTCCTTGGTAACAAGGACCC | Corresponds to FMDV nt 790–810 |
IRES 3 | CCTTCTCAGATCCCGAGTGT | Complementary to FMDV nt 987–968 |
IRES 4 | CCTATTCAGGCGTAGAAGCTT | Complementary to FMDV nt 1042–1022 |
Certain primers were also used as SNAP capture probes (see text).