Skip to main content
. 2022 Jan 18;11:e72072. doi: 10.7554/eLife.72072

Key resources table.

Reagent type (species) or resource Designation Source or reference Identifiers Additional information
Gene (Helianthus annuus) HaMYB111 INRA Sunflower Bioinformatics Resources HanXRQChr15g0465131
Gene (H. annuus) HaFLS1 INRA Sunflower Bioinformatics Resources HanXRQChr09g0258321
Gene (H. annuus) HaEF1α INRA Sunflower Bioinformatics Resources HanXRQChr11g0334971
Gene (Arabidopsis thaliana) AtMYB111; PFG3 The Arabidopsis Information Resource At5G49330
Gene (A. thaliana) AtMYB12; PFG1 The Arabidopsis Information Resource At2G47460
Strain, strain background (Helianthus spp.) Various Helianthus species and individuals USDA, North Central Regional Plant Introduction Station See Figure 1—source data 1 for full list
Strain, strain background (A. thaliana) Col-0 Arabidopsis Biological Resource Center CS28167
Genetic reagent (A. thaliana) myb111 Arabidopsis Biological Resource Center CS9813
Genetic reagent (A. thaliana) myb12 Arabidopsis Biological Resource Center CS9602
Genetic reagent (A. thaliana) myb12/myb111 Arabidopsis Biological Resource Center CS9980
Recombinant DNA reagent p35SCaMV:: HaMYB111 large This paper HaMYB111 CDS from sunflower lines with large LUVp, constitutive promoter
Recombinant DNA reagent p35SCaMV:: HaMYB111 small This paper HaMYB111 CDS from sunflower lines with small LUVp, constitutive promoter
Recombinant DNA reagent pAtMYB111:: HaMYB111 large This paper HaMYB111 CDS from sunflower lines with large LUVp, endogenous Arabidopsis promoter
Recombinant DNA reagent pAtMYB111:: HaMYB111 small This paper HaMYB111 CDS from sunflower lines with small LUVp, endogenous Arabidopsis promoter
Sequence-based reagent HaMYB111 CDS F This paper PCR primer ATGGGAAGGACCCCGTGTT
Sequence-based reagent HaMYB111 CDS R This paper PCR primer TTAAGACTGAAACCATGCATCTACC
Sequence-based reagent AtMYB111 promoter F This paper PCR primer CCTGTGCTTTAAGGCTCGAC
Sequence-based reagent AtMYB111 promoter R This paper PCR primer TGCTTCTCGGTCTCTTCTGT
Sequence-based reagent HaMYB111 qPCR F This paper PCR primer ATGGGAAGGACCCCGTGTT
Sequence-based reagent HaMYB111 qPCR R This paper PCR primer GCAACTCTTTCCGCATCTCA
Sequence-based reagent HaFLS1 qPCR F This paper PCR primer AAACTACTACCCACCATGCC
Sequence-based reagent HaFLS1 qPCR R This paper PCR primer TCCTTGTTCACTGTTGTTCTGT
Sequence-based reagent EF1α qPCR F This paper PCR primer GTGTGTGATGTCGTTCTCCA
Sequence-based reagent EF1α qPCR R This paper PCR primer ATTCCACCCAAAGCTTGCTC
Commercial assay or kit CloneJET PCR cloning kit Thermo Fisher Scientific Cat. #: K1231
Commercial assay or kit Custom TaqMan SNP Genotyping Assay Thermo Fisher Scientific Assay ID: ANKCD29
Commercial assay or kit TaqMan Genotyping Master Mix Thermo Fisher Scientific Cat. #: 4371355
Commercial assay or kit RevertAid RT Reverse Transcription Kit Thermo Fisher Scientific Cat. #: K1691
Commercial assay or kit SsoFast EvaGreen Supermix Bio-Rad Cat. #: 1725201
Peptide, recombinant protein Phusion High-Fidelity DNA Polymerase Thermo Fisher Scientific Cat. #: F530L
Chemical compound, drug PPM (Plant Preservative Mixture) Plant Cell Technologies
Chemical compound, drug TRIzol Reagent Thermo Fisher Scientific Cat. #: 15596026
Software, algorithm ImageJ ImageJ (https://imagej.nih.gov/ij/) RRID:SCR_003070 v2.0.0-rc-43/1.51o
Software, algorithm Trimmomatic Usadel lab (http://www.usadellab.org/cms/?page=trimmomatic) RRID:SCR_011848 v0.36
Software, algorithm NextGenMap NextGenMap (https://cibiv.github.io/NextGenMap/) RRID:SCR_005488 v0.5.3
Software, algorithm GATK Broad Institute (https://gatk.broadinstitute.org/hc/en-us) RRID:SCR_001876 v4.0.1.2
Software, algorithm Beagle University of Washington (https://faculty.washington.edu/browning/beagle/beagle.html) RRID:SCR_001789 10 Jun 18.811
Software, algorithm BWA BWA (https://github.com/lh3/bwa) RRID:SCR_010910 v0.7.17
Software, algorithm EMMAX University of Michigan – Center for Statistical Genetics (http://csg.sph.umich.edu//kang/emmax/download/index.html) v07 Mar 2010
Software, algorithm GEMMA GEMMA (https://github.com/genetics-statistics/GEMMA) v0.98.3
Software, algorithm GCTA_GREML GCTA (https://cnsgenomics.com/software/gcta) v1.93.2beta
Software, algorithm BOLT-REML BOLT-LMM (https://alkesgroup.broadinstitute.org/BOLT-LMM/BOLT-LMM_manual.html) v.2.3.5
Software, algorithm Agilent MassHunter Agilent (https://www.agilent.com/en/promotions/masshunter-mass-spec) RRID:SCR_015040
Software, algorithm R The R Project for Statistical Computing(https://www.r-project.org/) RRID:SCR_001905 v3.6.2
Software, algorithm ‘raster’ package Spatial Data Science (https://rspatial.org/raster/index.html)
Software, algorithm ‘interactions’ package CRAN (https://cran.r-project.org/web/packages/interactions/) v1.1.5
Software, algorithm BayPass BayPass (http://www1.montpellier.inra.fr/CBGP/software/baypass/) v2.1
Software, algorithm Fluke Connect Fluke (https://www.fluke.com/en-ca/products/fluke-software/connect) v.1.1.536.0