Table 2.

GISAID sequences with ambiguous bases at position 11 083

The sequence NC_045512.2 is included as the reference sequence of the original strain. Ambiguous bases are in bold type. The base at position 11 083 is underlined.

Accession no.	Country	Lineage – GISAID haplogroup	Patient status	Sequence (11073–11093)
Reference sequence
NC_045512.2	China	B – L	Symptomatic	TCTTTTTTTTGTATGAAAATG
GISAID sequences with an ambiguous base at position 11 083
EPI_ISL_454602	Croatia	B.1.1 – GR	Pre-symptomatic/Asymptomatic	TCTTTTTTTT N TATGAAAATG
EPI_ISL_539777	Czech Republic	B.1 – GH	Pre-symptomatic/Asymptomatic	TCTTTTTTTT K TATGAAAATG
EPI_ISL_626570	Czech Republic	B.1 – GH	Symptomatic	TCTTTTTTTNN TATGAAAATG
EPI_ISL_626613	Czech Republic	B.1.258 – G	Symptomatic	TCTTTTTTTNN TATGAAAATG
EPI_ISL_437454	India	B.6 – O	Symptomatic	TCTTTTTTTT N TATGAAAATG
EPI_ISL_479520	India	B.6 – O	Pre-symptomatic/Asymptomatic	TCTTTTTTTT N TATGAAAATG
EPI_ISL_436137	India	B.6 – O	Pre-symptomatic/Asymptomatic	TCTTTTTTTT N TATGAAAATG
EPI_ISL_436140	India	B.1.80 – G	Pre-symptomatic/Asymptomatic	TCTTTTTTTT N TATGAAAATG
EPI_ISL_436141	India	B.1.80 – G	Pre-symptomatic/Asymptomatic	TCTTTTTTTT N TATGAAAATG
EPI_ISL_436156	India	B.6 – O	Pre-symptomatic/Asymptomatic	TCTTTTTTTT N TATGAAAATG
EPI_ISL_436157	India	B.6 – O	Pre-symptomatic/Asymptomatic	TCTTTTTTTT N TATGAAAATG
EPI_ISL_486386	India	B.6 – O	Pre-symptomatic/Asymptomatic	TCTTTTTTTNN TATGAAAATG
EPI_ISL_486394	India	B.6 – O	Pre-symptomatic/Asymptomatic	TCTTTTTTTT N TATGAAAATG
EPI_ISL_486403	India	B.6 – O	Pre-symptomatic/Asymptomatic	TCTTTTTTTNN TATGAAAATG
EPI_ISL_486407	India	B.1 – S	Pre-symptomatic/Asymptomatic	TCTTTTTTTT N TATGAAAATG
EPI_ISL_486384	India	B.1 – O	Symptomatic	TCTNNNNNNNNNNNNNNNNNN
EPI_ISL_447776	Colombia	B.1 – GH	Symptomatic	NNNNNNNNNNNNNNNNNNNNN
EPI_ISL_447801	Colombia	B.1.5 – G	Symptomatic	NNNNNNNNNNNNNNNNNNNNN