Table 1.
No. | Initial Clinical Diagnosis |
Gene | Mutations | Zygosity | Segregation Analysis | gnomAD (MAF) | CADD | Previous Literature (PMID) |
ACMG Classification |
Accession ID for Transcript |
---|---|---|---|---|---|---|---|---|---|---|
1 | Cone-rod dystrophy | ABCA4 | c.1958G>A:p.(Arg653His) c.3470T>G:p.(Leu1157*) |
Compound heterozygous | NA | 10/280000 None |
25.9 43 |
10711710 29975949 |
LP P |
NM_000350.2 |
2 d | LCA | AHI1 | c.2174G>A:p.(Trp725*) | Homozygous | NA | 4/248916 | 43 | 25445212 | P | NM_001134831.1 |
3 d | Laurence-Moon syndrome |
BBS1 | c.908delT:p.(Val303Glyfs*29) c.1285C>T:p.(Arg429*) |
Compound heterozygous | Paternal Maternal |
None 3/251446 |
34 40 |
32165824 e 12677556 |
P P |
NM_024649.4 |
4 d | IIN | CACNA1F | Exon 13-23 deletion | Hemizygous | NA | None | NA | 34064005 e | P | NM_005183.2 |
5 d | LCA | CACNA1F | c.2175_2179delins CATCATGTATGATGGTATCATGGCATT:p.(Gly726Ilefs*61) | Hemizygous | Maternal | None | 28.3 | 34064005 e | P | NM_005183.2 |
6 d | IIN | CACNA1F | c.1910+1G>A | Hemizygous | NA | None | 21 | 34064005 e | P | NM_005183.2 |
LPR5 | c.3833G>A:p.(Trp1278*) | Heterozygous | NA | None | 45 | Novel | LP | NM_002335.2 | ||
7 d | IIN | CACNA1F | c.1301C>T:p.(Ala434Val) | Hemizygous | Maternal | None | 17.47 | 28002560 | LP | NM_005183.2 |
8 d | IIN | CACNA1F | c.1910+1G>A | Hemizygous | NA | None | 21 | 34064005 e | P | NM_005183.2 |
9 d | LCA | CEP290 | c.1666delA:p.(Ile556Phefs*17) c.3904C>T:p.(Gln1302*) |
Compound heterozygous |
Maternal Paternal |
245/174532 None |
31 37 |
16909394 25445212 |
P P |
NM_025114.3 |
10 | Achromatopsia | CNGA3 | c.1190G>T:p.(Glu397Val) a c.1279C>T:p.(Arg427Cys) a c.553C>G:p.(Leu185Val) |
Compound heterozygous |
Paternal Paternal Maternal |
None 110/281878 1/251394 |
25.5 33 20.5 |
18636117 11536077 31144483 |
LP LP LP |
NM_001298.2 |
11 d | Stickler syndrome | COL2A1 | c.3165+1G>A | Heterozygous | NA | None | 25.5 | 34680973 e | P | NM_001844.4 |
12 d | Pierre-Robin sequence |
COL2A1 | c.2680-3C>G | Heterozygous | NA | None | 23.7 | 34680973 e | P | NM_001844.4 |
13 d | LCA | CRX | c.101-1G>A b c.122G>A:p.(Arg41Gln) b |
Compound heterozygous |
Trans by IGV | None 1/31396 |
32 25.1 |
32165824 e 9427255 |
P P |
NM_000554.4 |
14 | Congenital cataract | CRYGC | c.173T>C:p.(Leu58Pro) | Heterozygous | NA | None | 26 | Novel | LP | NM_020989.3 |
15 | RP | EYS | c.8805C>G:p.(Tyr2935*) Exon 42-43 duplication |
Compound heterozygous |
NA | None None |
35 NA |
22363543 Novel |
LP US |
NM_001142800.1 |
16 | IIN | FRMD7 | c.368C>A:p.(Ser123Tyr) | Hemizygous | NA | None | 23.8 | Novel | LP | NM_194277.2 |
17 | IIN | FRMD7 | c.575A>C:p.(His192Pro) | Hemizygous | NA | 25/182271 | 25.6 | 30025138 | LP | NM_194277.2 |
18 | IIN | FRMD7 | c.637G>A:p.(Val213Met) | Heterozygous | NA | None | 32 | Novel | LP | NM_194277.2 |
19 | IIN | FRMD7 | c.685C>T:p.(Arg229Cys) | Hemizygous | NA | None | 34 | 17768376 | P | NM_194277.2 |
20 | IIN | FRMD7 | c.772A>G:p.(Lys241Arg) | Hemizygous | NA | None | 27.4 | 31106028 | LP | NM_194277.2 |
21 | IIN | FRMD7 | c.875T>C:p.(Leu292Pro) | Heterozygous | NA | 4/183318 | 27.5 | 25678693 | P | NM_194277.2 |
22 | IIN | FRMD7 | c.875T>C:p.(Leu292Pro) | Hemizygous | NA | 4/183318 | 27.5 | 25678693 | P | NM_194277.2 |
23 | IIN | FRMD7 | c.875T>C:p.(Leu292Pro) | Heterozygous | NA | 4/183318 | 27.5 | 25678693 | P | NM_194277.2 |
24 | IIN | FRMD7 | c.875T>C:p.(Leu292Pro) | Heterozygous | NA | 4/183318 | 27.5 | 25678693 | P | NM_194277.2 |
25 | IIN | FRMD7 | c.875T>C:p.(Leu292Pro) | Hemizygous | NA | 4/183318 | 27.5 | 25678693 | P | NM_194277.2 |
26 | IIN | FRMD7 | c.875T>C:p.(Leu292Pro) | Hemizygous | NA | 4/183318 | 27.5 | 25678693 | P | NM_194277.2 |
27 | IIN | FRMD7 | c.875T>C:p.(Leu292Pro) | Hemizygous | NA | 4/183318 | 27.5 | 25678693 | P | NM_194277.2 |
28 | IIN | FRMD7 | c.875T>C:p.(Leu292Pro) | Hemizygous | NA | 4/183318 | 27.5 | 25678693 | P | NM_194277.2 |
29 | IIN | FRMD7 | c.875T>C:p.(Leu292Pro) | Hemizygous | NA | 4/183318 | 27.5 | 25678693 | P | NM_194277.2 |
30 | IIN | FRMD7 | c.875T>C:p.(Leu292Pro) | Hemizygous | NA | 4/183318 | 27.5 | 25678693 | P | NM_194277.2 |
31 | IIN | FRMD7 | c.875T>C:p.(Leu292Pro) | Hemizygous | NA | 4/183318 | 27.5 | 25678693 | P | NM_194277.2 |
32 | IIN | FRMD7 | c.875T>C:p.(Leu292Pro) | Hemizygous | NA | 4/183318 | 27.5 | 25678693 | P | NM_194277.2 |
33 | IIN | FRMD7 | c.886G>T:p.(Gly296Cys) | Hemizygous | NA | None | 34 | 30015830 | LP | NM_194277.2 |
34 | IIN | FRMD7 | c.901T>C:p.(Tyr301His) | Hemizygous | NA | None | 26.7 | 29145603 e | LP | NM_194277.2 |
35 | IIN | FRMD7 | c.1016C>G:p.(Ser339Cys) | Hemizygous | NA | None | 34 | Novel | LP | NM_194277.2 |
36 | IIN | FRMD7 | c.1023_1030AGACCTCC: p.(Asp342Leufs*2) |
Hemizygous | NA | None | 35 | Novel | P | NM_194277.2 |
37 | IIN | FRMD7 | Exon 5 deletion | Hemizygous | NA | None | NA | Novel | P | NM_194277.2 |
38 | Congenital cataract | FTL | c.-168G>T | Heterozygous | Maternal | None | 20.8 | 9414300 | P | NM_000146.3 |
39 | FEVR | FZD4 | c.752C>G:p.(Pro251Arg) | Heterozygous | Maternal | None | 25.1 | Novel | LP | NM_012193.3 |
40 | FEVR | FZD4 | c.205C>T:p.(His69Tyr) | Heterozygous | NA | 138/277634 | 24.2 | 15370539 | P | NM_012193.3 |
41 | FEVR | FZD4 | c.470T>C:p.(Met157Thr) | Heterozygous | NA | None | 21.8 | 21097938 | P | NM_012193.3 |
42 | Congenital cataract | GJA3 | c.290T>G:p.(Leu97Arg) | Heterozygous | NA | None | 29 | Novel | US | NM_021954.3 |
OPA1 | c.449-2A>C | Heterozygous | NA | None | 23.6 | Novel | P | NM_130832.2 | ||
43 | Ocular albinism | GPR143 | c.248T>C:p.(Leu83Pro) | Hemizygous | NA | None | 25.9 | 31106028 | LP | NM_000273.2 |
44 | Ocular albinism | GPR143 | c.360+2T>C | Hemizygous | NA | None | 23 | Novel | P | NM_000273.2 |
45 | Ocular albinism | GPR143 | c.925delG:p.(Ala309Profs*24) | Hemizygous | NA | None | 34 | Novel | P | NM_000273.2 |
46 | Ocular albinism | GPR143 | c.518C>G:p.(Ala173Asp) | Hemizygous | NA | None | 24.2 | Novel | LP | NM_000273.2 |
47 | Ocular albinism | GPR143 | Xp22.3 deletion | Hemizygous | NA | None | - | Novel | P | - |
48 | Ocular albinism | GPR143 | c.223_228dupGCTGCC: p.(Ala75_Ala76dup) |
Hemizygous | NA | None | 8.758 | 28339057 | LP | NM_000273.2 |
49 d | LCA | GUCY2D | c.1991A>C:p.(His664Pro) c.2984G>A:p.(Arg995Gln) |
Compound heterozygous | Maternal Paternal |
None 1/244998 |
27 35 |
28966547 32165824 e |
P LP |
NM_000180.3 |
50 d | LCA | GUCY2D | c.2649del:p.(Phe883Leufs*13) | Homozygous | NA | None | 33 | 28966547 | P | NM_000180.3 |
51 d | LCA | GUCY2D | c.1790G>A:p.(Gly597Glu) exon 4-5 duplication |
Compound heterozygous | Paternal De novo |
None None |
27.4 - |
29068479 32165824 e |
LP LP |
NM_000180.3 |
52 d | IIN | GUCY2D | c.1978C>T:p.(Arg660*) c.2947C>A:p.(Pro983Thr) a c.2960G>C:p.(Gly987Ala) a |
Compound heterozygous | Paternal Maternal |
1/251328 None None |
40 25.3 28.4 |
10766140 32165824 e 32165824 e |
P LP LP |
NM_000180.3 |
53 | CCDD | KIF21A | c.1067T>C:p.(Met356Thr) | Heterozygous | Maternal | None | 25.4 | 14595441 | LP | NM_001173464.1 |
54 | FEVR | LRP5 | c.607G>A:p.(Asp203Asn) | Heterozygous | Paternal | None | 32 | 16252235 | P | NM_002335.2 |
55 | Congenital cataract | NHS | c.1117C>T:p.(Arg373*) | Heterozygous | NA | None | 38 | 14564667 | P | NM_198270.2 |
56 d | LCA | NMNAT1 | c.275G>A:p.(Trp92*) c.709C>T:p.(Arg237Cys) |
Compound heterozygous | Paternal Maternal |
None 14/282780 |
38 35 |
32165824 e 22842227 |
LP P |
NM_022787.3 |
57 d | LCA | NMNAT1 | c.196C>T:p.(Arg66Trp) c.709C>T:p.(Arg237Cys) |
Compound heterozygous | Paternal Maternal |
22/282832 14/282780 |
35 35 |
22842227 22842227 |
P P |
NM_022787.3 |
58 d | Optic atrophy | NR2F1 | c.91_93dupCGC:p.(Arg31dup) | Heterozygous | NA | None | 19.92 | 34466801 e | LP | NM_005654.4 |
59 d | Optic atrophy | NR2F1 | c.513C>G:p.(Tyr171*) | Heterozygous | NA | None | 37 | 34466801 e | LP | NM_005654.4 |
60 d | IIN | NYX | c.182_183insT: p.(Cys62Valfs*53) |
Hemizygous | Maternal | None | 32 | 34064005 e | P | NM_022567.2 |
61 | Unexplained visual loss | NYX | c.38-1_38delGCinsTT: p.(Ala13Vafs*102) |
Hemizygous | Maternal | None | 14.49 | ClinVar | P | NM_022567.2 |
62 | Optic atrophy | OPA1 | c.1240A>C:p.(Thr414Pro) | Heterozygous | NA | None | 26.5 | 26905822 | LP | NM_015560.2 |
63 | Optic atrophy | OPA1 | c.795_798delTGAC: p.(Asp266Cysfs*41) |
Heterozygous | NA | None | 35 | Novel | P | NM_015560.2 |
64 | PAX6 phenotype | PAX6 | c.383G>A:p.(Arg128His) | Heterozygous | NA | None | 34 | 30167917 | LP | NM_000280.4 |
65 | PAX6 phenotype | PAX6 | c.607C>T:p.(Arg203*) | Heterozygous | NA | None | 36 | 7550230 | P | NM_000280.4 |
66 | PAX6 phenotype | PAX6 | c.397G>T:p.(Glu133*) | Heterozygous | NA | None | 38 | 16712695 | P | NM_000280.4 |
67 | PAX6 phenotype | PAX6 | c.702T>A:p.(Tyr234*) | Heterozygous | NA | None | 36 | Novel | P | NM_000280.4 |
68 | PAX6 phenotype | PAX6 | c.362C>T:p.(Ser121Leu) | Heterozygous | NA | None | 25.9 | 23734086 | LP | NM_000280.4 |
69 | PAX6 phenotype | PAX6 | c.607C>T:p.(Arg203*) | Heterozygous | NA | None | 37 | 7550230 | P | NM_000280.4 |
70 | PAX6 phenotype | PAX6 | c.702T>A:p.(Tyr234*) | Heterozygous | NA | None | 36 | Novel | P | NM_000280.4 |
71 | Achromatopsia | PDE6C | c.1771G>A:p.(Glu591Lys) c.2269C>T:p.(Gln757*) |
Compound heterozygous | Paternal Maternal |
2/251120 None |
33 49 |
26992781 Novel |
P P |
NM_006204.3 |
72 | Achromatopsia | PDE6C | c.85C>T:p.(Arg29Trp) c.712C>T:p.(Arg238*) |
Compound heterozygous | Maternal Paternal |
6/282886 2/251376 |
29.3 38 |
19615668 27124789 |
P P |
NM_006204.3 |
73 | Optic atrophy | PDHA1 | c.232G>A:p.(Ala78Thr) | Hemizygous | Maternal | None | 24.8 | Novel | LP | NM_000284.3 |
74 | RP | PRPH2 | c.708C>G:p.(Tyr236*) | Heterozygous | Paternal | None | 37 | 22863181 | P | NM_000322.4 |
75 | CSNB | RHO | c.302G>A:p.(Gly101Glu) | Heterozygous | NA | 2/250994 | 25.5 | 26161267 | LP | NM_000539.3 |
76 | Cone dystrophy | RP1 | c.4196delG:p.(Cys1399Leufs*5) c.6181delA:p.(Ile2061Serfs*12) |
Compound heterozygous | NA | None None |
23.7 23 |
25097241 29425069 |
P P |
NM_006269.1 |
77 | LCA | RPGRIP1 | c.3565_3571delCGAAGGC: p.(Arg1189Glyfs*7) |
Homozygous | NA | 4/249114 | 35 | 18682808 | P | NM_020366.3 |
78 d | PAX6 phenotype | SLC38A8 | c.692G>A:p.(Cys231Tyr) c.964C>T:p.(Gln322*) |
Compound heterozygous | Paternal Maternal |
None 2/248656 |
27.2 37 |
32744312 e 32744312 e |
LP P |
NM_001080442.1 |
79 d | Ocular albinism | SLC38A8 | c.995dupG:p.(Trp333Metfs*35) c.1214+5G>C |
Compound heterozygous | Paternal Maternal |
None None |
22.9 23.2 |
32744312 e 32744312 e |
P LP |
NM_001080442.1 |
80 d | PAX6 phenotype | SLC38A8 | c.558C>A:p.(Tyr186*) c.1078_1104del: p.(Ala360_leu368del) |
Compound heterozygous | Maternal Paternal |
None None |
58 16.29 |
32744312 e 32744312 e |
P LP |
NM_001080442.1 |
81 | Oculocutaneous albinism |
SLC45A2 | c.220T>C:p.(Trp74Arg) | Heterozygous | Maternal | None | 26.7 | Novel | US | NM_016180.3 |
82 d | LCA | SPATA7 | c.388C>T:p.(Gln130*) c.1160+1G>A |
Compound heterozygous | Maternal Paternal |
2/249908 None |
35 33 |
32165824 e 32165824 e |
P P |
NM_018418.4 |
83 d | LCA | TUBB3 | c.967A>G:p.(Met323Val) | Heterozygous | De novo | None | 25.3 | 33921132 e | LP | NM_006086.4 |
84 | Oculocutaneous albinism |
TYR | c.929dupC:p.(Arg311Lysfs*7) c.1037-7T>A |
Compound heterozygous | NA | 11/251178 242/280983 |
22.9 18.81 |
2511845 8217557 |
P P |
NM_000372.4 |
85 | Usher syndrome | USH2A | c.2802T>G:p.(Cys934Trp) c.11389+3A>T |
Compound heterozygous | Son c | 57/282482 2/250762 |
26.6 22.7 |
21686329 28714225 |
P LP |
NM_206933.2 |
86 | Usher syndrome | USH2A | c.8559-2A>G | Homozygous | NA | 8/251134 | 34 | 32093671 | P | NM_206933.2 |
87 | X-linked retinoschisis |
VPS13B | c.6200T>A:p.(Leu2067*) c.9530_9531del: p.(Ala3177Valfs*18) |
Compound heterozygous | NA | 3/250746 None |
39 27.5 |
15141358 Novel |
P P |
NM_017890.4 |
88 | Corneal dystrophy | ZEB1 | c.2034_2035delAA: p.(Pro680Phefs*5) |
Heterozygous | NA | None | 23.8 | Novel | P | NM_030751.5 |
89 | Corneal dystrophy | ZEB1 | c.1576delG:p.(Val526*) | Heterozygous | NA | None | 23.9 | Novel | P | NM_030751.5 |
90 | Optic atrophy | SOX5 | 12p12.2p12.1 deletion | Heterozygous | De novo | None | NA | Novel | P | NM_006940.4 |
ACMG: American College of Medical Genetics, CADD: combined annotation-dependent depletion, CCDD: congenital cranial dys-innervational disorder, FEVR: familial exudative vitreoretinopathy, IGV: integrative genomic viewer, IIN: idiopathic infantile nystagmus, gnomAD: genome aggregation dataset, LCA: Leber congenital amaurosis, LP: likely pathogenic, MAF: minor allele frequency, NA: not available, P: pathogenic, RP: retinitis pigmentosa, US: uncertain significance. a These two variants were existed in cis, confirmed by manual inspection through integrative genomic viewer. b These two variants were existed in trans, confirmed by manual inspection through integrative genomic viewer. c Segregation was confirmed by proband’s children. d Previously reported patients by the authors. e Novel, but previously reported by the authors.