Key resources table.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Mus musculus, male) | BALB/cJ | Own colony, Jackson Labs | JAX #000651 | |
| Strain, strain background (M. musculus, male) | C57BL/6J | Own colony, Jackson Labs | JAX #000664 | |
| Strain, strain background (M. musculus, male) | KRT18-hACE2 | Own colony, Jackson Labs | JAX #034860 | |
| Strain, strain background (M. musculus, male) | Ace2-/y | Own colony, Jackson Labs Crackower et al., 2002 |
||
| Strain, strain background (SARS-CoV-2) | BavPat1/2020 | Charité, Berlin, Germany | European Virology Archive# 026V-03883 | |
| Strain, strain background (SARS-CoV-2) | maVie16 | This study | This study | |
| Cell line (Chlorocebus) | Vero | ATCC | CCL-81 | |
| Cell line (Chlorocebus) | Vero TMPRSS2 (OE) | This study | This study | |
| Cell line (human) | Caco-2 | ATCC | HTB37 | |
| Antibody | Fixable Viability Dye eFluor 780 | Thermo Fisher, eBioscience | Cat# 65-0865-14 | FC (1:3000) |
| Antibody | anti-mouse CD16/32 (monoclonal rat) | BioLegend | Cat# 101320; RRID:AB_1574975 | FC (1:50) |
| Antibody | BV510 anti-mouse CD45 (monoclonal rat) | BioLegend | Cat# 103138; RRID:AB_2563061 | FC (1:200) |
| Antibody | PE anti-mouse CD45 (monoclonal rat) | BioLegend | Cat# 103106; RRID:AB_312971 | FC (1:200) |
| Antibody | PE/dazzle 594 anti-mouse CD45.2 (monoclonal mouse) | BioLegend | Cat# 109845; RRID:AB_2564176 | FC (1:200) |
| Antibody | PE anti-mouse CD45R (monoclonal rat) | BioLegend | Cat# 103208; RRID:AB_312993 | FC (1:200) |
| Antibody | PE anti-mouse F4/80 (monoclonal rat) | BioLegend | Cat# 123110; RRID:AB_893486 | FC (1:200) |
| Antibody | Alexa Fluor 700 anti-mouse CD11b (monoclonal rat) | BioLegend | Cat# 101222; RRID:AB_493705 | FC (1:200) |
| Antibody | PE/Cyanine7 anti-mouse CD11b (monoclonal rat) | BioLegend | Cat# 101215; RRID:AB_312798 | FC (1:200) |
| Antibody | Brilliant Violet 605 anti-mouse CD11b (monoclonal rat) | BioLegend | Cat# 101237; RRID:AB_11126744 | FC (1:200) |
| Antibody | PE anti-mouse CD11b (monoclonal rat) | BioLegend | Cat# 101208; RRID:AB_312791 | FC (1:200) |
| Antibody | APC anti-mouse CD11c (monoclonal Armenian hamster) | BioLegend | Cat# 117310; RRID:AB_313779 | FC (1:200) |
| Antibody | PE-Texas Red anti-mouse CD11c (monoclonal Armenian hamster) | Thermo Fisher | Cat# MCD11C17;RRID:AB_10373971 | FC (1:200) |
| Antibody | PE anti-mouse CD11c (monoclonal Armenian hamster) | BD Biosciences | Cat# 557401; RRID:AB_396684 | FC (1:200) |
| Antibody | Brilliant Violet 510 anti-mouse Ly-6C (monoclonal rat) | BioLegend | Cat# 128033; RRID:AB_2562351 | FC (1:200) |
| Antibody | PE/Cy7 anti-mouse Ly-6G (monoclonal rat) | BioLegend | Cat# 127617; RRID:AB_1877262 | FC (1:200) |
| Antibody | FITC anti-mouse Ly-6G (monoclonal rat) | BioLegend | Cat# 127605; RRID:AB_1236488 | FC (1:200) |
| Antibody | BV510 anti-mouse Ly-6G (monoclonal rat) | BioLegend | Cat# 127633; RRID:AB_2562937 | FC (1:200) |
| Antibody | PE anti-mouse Ly6G (monoclonal rat) | BioLegend | Cat# 127608; RRID:AB_1186099 | FC (1:200) |
| Antibody | PerCP-Cy5.5 Siglec-F (monoclonal rat) | BD Biosciences | Cat# 565526; RRID:AB_2739281 | FC (1:100) |
| Antibody | eFluor 450 anti-mouse MHC Class II (I-A/I-E) (monoclonal rat) | Thermo Fisher | Cat# 48-5321-82; RRID:AB_1272204 | FC (1:200) |
| Antibody | BV605 anti-mouse CD115 (monoclonal rat) | BioLegend | Cat# 135517; RRID:AB_2562760 | FC (1:100) |
| Antibody | FITC anti-mouse CD19 (monoclonal rat) | BioLegend | Cat# 115506; RRID:AB_313641 | FC (1:200) |
| Antibody | BV605 anti-mouse CD19 (monoclonal rat) | BioLegend | Cat# 115540; RRID:AB_2563067 | FC (1:200) |
| Antibody | PE anti-mouse CD19 (monoclonal rat) | BioLegend | Cat# 115507; RRID:AB_313642 | FC (1:200) |
| Antibody | FITC anti-mouse CD3 (monoclonal rat) | BioLegend | Cat# 100204; RRID:AB_312661 | FC (1:200) |
| Antibody | PE/Dazzle 594 anti-mouse CD3 (monoclonal rat) | BioLegend | Cat# 100245; RRID:AB_2565882 | FC (1:200) |
| Antibody | PerCP/Cy5.5 anti-mouse CD3 (monoclonal rat) | BioLegend | Cat# 100217; RRID:AB_1595597 | FC (1:200) |
| Antibody | eFluor450 anti-mouse CD3 (monoclonal rat) | BioLegend | Cat# 100213; RRID:AB_493644 | FC (1:200) |
| Antibody | PE anti-mouse CD3 (monoclonal rat) | BioLegend | Cat# 100205; RRID:AB_312662 | FC (1:200) |
| Antibody | FITC anti-mouse CD4 (monoclonal rat) | BioLegend | Cat# 100406; RRID:AB_312691 | FC (1:100) |
| Antibody | AF700 anti-mouse CD4 (monoclonal rat) | BioLegend | Cat# 100429; RRID:AB_493698 | FC (1:100) |
| Antibody | PerCP/Cy5.5 anti-mouse CD4 (monoclonal rat) | BioLegend | Cat# 100433; RRID:AB_893330 | FC (1:100) |
| Antibody | PE anti-mouse CD4 (monoclonal rat) | BioLegend | Cat# 100407; RRID:AB_312692 | FC (1:100) |
| Antibody | AF700 anti-mouse CD8a (monoclonal rat) | BioLegend | Cat# 100729; RRID:AB_493702 | FC (1:200) |
| Antibody | Pacific Blue anti-mouse CD8a (monoclonal rat) | BioLegend | Cat# 100728; RRID:AB_493426 | FC (1:200) |
| Antibody | PE anti-mouse CD8a (monoclonal rat) | BioLegend | Cat# 100707; RRID:AB_312746 | FC (1:200) |
| Antibody | PE anti-mouse TCRβ chain (monoclonal Armenian hamster) | BioLegend | Cat# 109207; RRID:AB_313430 | FC (1:200) |
| Antibody | PE anti-mouse TCRγδ (monoclonal Armenian hamster) | BioLegend | Cat# 118107; RRID:AB_313831 | FC (1:200) |
| Antibody | PerCP/Cy5.5 anti-mouse NK-1.1 (monoclonal mouse) | BioLegend | Cat# 108727; RRID:AB_2132706 | FC (1:100) |
| Antibody | APC anti-mouse NK-1.1 (monoclonal mouse) | BioLegend | Cat# 108709; RRID:AB_313396 | FC (1:100) |
| Antibody | PE anti-mouse FcεRIα (monoclonal Armenian hamster) | BioLegend | Cat# 134307; RRID:AB_1626104 | FC (1:100) |
| Antibody | PE/Cy7 anti-mouse CD117 (c-kit) (monoclonal rat) | BioLegend | Cat# 105813; RRID:AB_313222 | FC (1:100) |
| Antibody | BV421 anti-mouse CD193 (CCR3) (monoclonal rat) | BioLegend | Cat# 144517; RRID:AB_2565743 | FC (1:100) |
| Antibody | Alexa Fluor 647 anti-mouse CD49b (monoclonal rat) | BioLegend | Cat# 108912; RRID:AB_492880 | FC (1:100) |
| Antibody | AF700 anti-mouse CD49b (monoclonal rat) | Thermo Fisher | Cat# 56-5971-80; RRID:AB_2574506 | FC (1:100) |
| Antibody | PE/Dazzle 594 anti-mouse CD64 (FCγRI) (monoclonal mouse) | BioLegend | Cat# 139319; RRID:AB_2566558 | FC (1:200) |
| Antibody | AF700 anti-mouse CD43 (monoclonal rat) | BioLegend | Cat# 143213; RRID:AB_2800660 | FC (1:200) |
| Antibody | APC anti-mouse CD44 (monoclonal rat) | BioLegend | Cat# 103012; RRID:AB_312963 | FC (1:200) |
| Antibody | BV510 anti-mouse CD138 (monoclonal rat) | BD Biosciences | Cat# 563192; RRID:AB_2738059 | FC (1:100) |
| Antibody | PerCP/Cy5.5 anti-mouse CD21/CD35 (CR2/CR1) (monoclonal rat) | BioLegend | Cat# 123416; RRID:AB_1595490 | FC (1:100) |
| Antibody | AF647 anti-mouse CD23 (monoclonal rat) | BD Biosciences | Cat# 562826; RRID:AB_2737821 | FC (1:200) |
| Antibody | PE-Cy7anti-mouse CD93 (AA4.1) (monoclonal rat) | Thermo Fisher | Cat# 25-5892-82; RRID:AB_469659 | FC (1:200) |
| Antibody | eFluor450 anti-mouse CD90.2 (Thy1.2) (monoclonal rat) | BioLegend | Cat# 140305; RRID:AB_10645335 | FC (1:200) |
| Antibody | FITC anti-mouse MERTK (monoclonal rat) | BioLegend | Cat# 151504; RRID:AB_2617035 | FC (1:100) |
| Antibody | PE anti-mouse MERTK (monoclonal rat) | BioLegend | Cat# 151505; RRID:AB_2617036 | FC (1:100) |
| Antibody | BV605 anti-mouse CD127 (IL-7α) (monoclonal rat) | BioLegend | Cat# 135025; RRID:AB_2562114 | FC (1:100) |
| Antibody | eFluor450 anti-mouse IgM (monoclonal rat) | Thermo Fisher | Cat# 48-5890-82;RRID:AB_10671539 | FC (1:200) |
| Antibody | FITC anti-mouse IgD (monoclonal rat) | BioLegend | Cat# 405704; RRID:AB_315026 | FC (1:200) |
| Antibody | PE anti-mouse IgA (monoclonal rat) | Thermo Fisher | Cat# 12-4204-83; RRID:AB_465918 | FC (1:200) |
| Antibody | BV605 anti-mouse CD62L (monoclonal rat) | BioLegend | Cat# 104438; RRID:AB_2563058 | FC (1:200) |
| Antibody | APC/Cy7 anti-mouse TER-119 (monoclonal rat) | BioLegend | Cat# 116223; RRID:AB_2137788 | FC (1:200) |
| Antibody | Biotin anti-mouse IgG1 (monoclonal rat) | BD Pharmingen | Cat# 553441 | ELISA (1:1000) |
| Antibody | Biotin anti-mouse IgG2b (monoclonal rat) | BD Pharmingen | Cat# 553393 | ELISA (1:1000) |
| Antibody | Biotin anti-mouse IgA (polyclonal goat) | Southern Biotech | Cat# 1040-08 | ELISA (1:1000) |
| Antibody | Anti-SARS nucleocapsid (polyclonal rabbit) | Novus Biologicals | Cat# NB100-56576 | IHC (1:1000) |
| Antibody | Biotin anti-rabbit IgG (polyclonal goat) | Vector Labs | Cat# BA-1000 | IHC (1:200) |
| Antibody | Anti-mouse TNF (neutralizing) (monoclonal rat) | In house | Clone XT22 | 2 × 500 µg/200 µl/mouse i.p. |
| Antibody | Anti-mouse IFNg (neutralizing) (monoclonal rat) | In house | Clone XMG 1.2 | 2 × 500 µg/200 µl/mouse i.p. |
| Antibody | Anti-ß-galactosidase (IgG1 isotype control) (monoclonal rat) | In house | Clone GL113 | 2 × 500 µg/200 µl/mouse i.p. |
| Recombinant DNA reagent | pIRES2-AcGFP1 (Plasmid) | Clontech | Cat# 632435 | |
| Recombinant DNA reagent | pIRES2-SC2quant | This study | Plasmid containing a PCR-amplified sequence of BavPat1; used as standard for quantification of virus genome copy numbers | |
| Recombinant DNA reagent | pBluescript KS(-) | Stratagene | Cat# 212208 | |
| Recombinant DNA reagent | pBMN-I-GFP | Addgene | Plasmid 1736 | |
| Recombinant DNA reagent | pBMN-TMPRSS2-I-GFP | This study | Plasmid containing the PCR-amplified coding sequence of human TMPRSS2; used to transfect Vero cells to enhance in vitro virus propagation | |
| Sequence-based reagent | CoV-F3_XhoI | This study | PCR primers, Microsynth | CTCGAGTTTCCTGGTGATTCTTCTTCAGGT |
| Sequence-based reagent | CoV-R3_BamHI | This study | PCR primers, Microsynth | CCTAGGTCTGAGAGAGGGTCAAGTGC |
| Sequence-based reagent | CoV-F3 | Gu et al., 2020 | PCR primers, Microsynth | TCCTGGTGATTCTTCTTCAGGT |
| Sequence-based reagent | CoV-R3 | Gu et al., 2020 | PCR primers, Microsynth | TCTGAGAGAGGGTCAAGTGC |
| Sequence-based reagent | CoV-P3 | Gu et al., 2020 | PCR primers, Microsynth | AGCTGCAGCACCAGCTGTCCA (FAM/TAMRA-labeled) |
| Sequence-based reagent | Mouse Adar1_fwd | This study | PCR primers, Microsynth | GATGACCAGTCTGGAGGTGC |
| Sequence-based reagent | Mouse Adar1_rev | This study | PCR primers, Microsynth | GCAGCAAAGCCATGAGATCG |
| Sequence-based reagent | Mouse Eif2ak2_fwd | This study | PCR primers, Microsynth | AAGTACAAGCGCTGGCAGAA |
| Sequence-based reagent | Mouse Eif2ak2_rev | This study | PCR primers, Microsynth | GCACCGGGTTTTGTATCGAC |
| Sequence-based reagent | Mouse Ifng_fwd | This study | PCR primers, Microsynth | ACTGGCAAAAGGATGGTGACA |
| Sequence-based reagent | Mouse Ifng_rev | This study | PCR primers, Microsynth | TGGACCTGTGGGTTGTTGAC |
| Sequence-based reagent | Mouse Ifit1_fwd | This study | PCR primers, Microsynth | CAGCAACCATGGGAGAGAATGCTGA |
| Sequence-based reagent | Mouse Ifit1_rev | This study | PCR primers, Microsynth | GGCACAGTTGCCCCAGGTCG |
| Sequence-based reagent | Mouse Il1b_fwd | This study | PCR primers, Microsynth | CAAAATACCTGTGGCCTTGG |
| Sequence-based reagent | Mouse Il1b_rev | This study | PCR primers, Microsynth | TACCAGTTGGGGAACTCTGC |
| Sequence-based reagent | Mouse Il6_fwd | This study | PCR primers, Microsynth | CCACGGCCTTCCCTACTTCA |
| Sequence-based reagent | Mouse Il6_rev | This study | PCR primers, Microsynth | TGCAAGTGCATCGTTGTTC |
| Sequence-based reagent | Mouse Il10_fwd | This study | PCR primers, Microsynth | TGAGGCGCTGTCATCGATTT |
| Sequence-based reagent | Mouse Il10_rev | This study | PCR primers, Microsynth | CATGGCCTTGTAGACACCTT |
| Sequence-based reagent | Mouse Tgfb_fwd | This study | PCR primers, Microsynth | AGCCCGAAGCGGACTAT |
| Sequence-based reagent | Mouse Tgfb_rev | This study | PCR primers, Microsynth | TCCACATGTTGCTCCACACT |
| Sequence-based reagent | Mouse Tnf_fwd | This study | PCR primers, Microsynth | GCGTGGAGCTGAGAGATAACC |
| Sequence-based reagent | Mouse Tnf_rev | This study | PCR primers, Microsynth | GATCCCAAAGTAGACCTGCCC |
| Sequence-based reagent | Human TMPRSS2_fwd | This study | PCR primers | AACCTGGGCGCCTGGGA |
| Sequence-based reagent | Human TMPRSS2_rev | This study | PCR primers | ACGTCAAGGACGAAGACCATGTG |
| Peptide, recombinant protein | Collagenase I | Gibco/Thermo Fisher Scientific | 17018029 | |
| Peptide, recombinant protein | DNAse I | Sigma | DN25 | |
| Peptide, recombinant protein | Recombinant SARS-CoV-2 Spike protein ectodomain | Reingard Grabherr, BOKU Vienna Klausberger et al., 2021 |
||
| Peptide, recombinant protein | mrsACE2 | In house (APEIRON Biologics) Monteil et al., 2020 |
||
| Commercial assay or kit | ROTI Prep RNA Mini | Carl Roth | Cat# 8485.1 | |
| Commercial assay or kit | QIAamp Viral RNA Mini Kit | QIAGEN | Cat# 52904 | |
| Commercial assay or kit | E.Z.N.A Viral RNA kit | Omega Bio-tek | Cat# R6874 | |
| Commercial assay or kit | qScript cDNA Synthesis Kit | Quantabio | Cat# 95047-500 | |
| Commercial assay or kit | PerfeCTa SYBR Green SuperMix | Quantabio | Cat# 95055 | |
| Commercial assay or kit | VectastainABC kit | Vector Labs | Cat# PK-6100 | |
| Commercial assay or kit | DAB Substrate kit | Vector Labs | Cat# SK-4100 | |
| Commercial assay or kit | LEGENDplex Macrophage/Microglia Panel | BioLegend | Cat# 740846 | |
| Commercial assay or kit | LEGENDplex MU Th Cytokine Panel V02 | BioLegend | Cat# 740741 | |
| Chemical compound, drug | Sodium pyruvate (100 mM) | Thermo Fisher Scientific | Cat# 11360070 | |
| Chemical compound, drug | Penicillin streptomycin (10,000 U/ml) | Thermo Fisher Scientific | Cat# 15140122 | |
| Chemical compound, drug | MEM nonessential amino acids (100×) | Thermo Fisher Scientific | Cat# 11140050 | |
| Chemical compound, drug | RLT Plus | QIAGEN | Cat# 1053393 | |
| Chemical compound, drug | 2-Mercaptoethanol | Sigma-Aldrich | Cat# M3148 | |
| Chemical compound, drug | Antigen Unmasking Solution | Vector Labs | Cat# H3300-250 | |
| Chemical compound, drug | Hematoxylin solution (Mayer’s) | Sigma-Aldrich | Cat# MHS16 | |
| Software, algorithm | GraphPad Prism 9.1 | GraphPad Software, Inc. | https://www.graphpad.com | |
| Software, algorithm | FlowJo | Becton, Dickinson and Company | https://www.flowjo.com/ | |
| Other | Dulbecco’s Modified Eagle’s Medium | Thermo Fisher Scientific | Cat# 10564011 | High glucose, GlutaMAX, HEPES |
| Other | Fetal bovine serum | Sigma | Cat# F9665 | |
| Other | Goat serum | Novus Biologicals | Cat# NBP2-23475 |