| Antibodies |
|
| Immune Cell Profiling Panel (Core) |
Nanostring Technologies, Inc |
GMX-PROCONCT-HICP-12, Item 121300101, Lot# 0474026 |
| 10 Drug Target Panel |
Nanostring Technologies, Inc |
GMX-PROMODNCT-HIODT-12, Item 121300102, Lot# 0474029 |
| Immune Activation Status Panel |
Nanostring Technologies, Inc. |
GMX-PROMODNCT-HIAS-12, Item 121300103, Lot# 0474032 |
| Immune Cell Typing Panel |
Nanostring Technologies, Inc |
GMX-PROMODNCT-HICT-12, Item 121300104, Lot# 0474035 |
| Cell Death Panel |
Nanostring Technologies, Inc |
GMX-PROMOD-NCTHCD-12, Lot# 0474050 |
| MAPK Signaling Panel |
Nanostring Technologies, Inc |
GMX-PROMOD-NCTHMAPK-12, Lot# 0474047 |
| Pl3K/AKT Signaling Panel |
Nanostring Technologies, Inc |
GMX-PROMOD-NCTHPl3K-12, Lot# 0474053 |
| COVID-19 GeoMx-formatted Antibody Panel including (TMPRSS2, clone EPR3861; ACE2, clone EPR4436; Cathepsin L/V/K/H, clone EPR8011; DDX5, clone EPR7239; and SARS-CoV-2 spike glycoprotein, polyclonal) |
Abcam |
ab273594, Lot# GR3347471-1 |
| GeoMx Solid Tumor TME Morphology Kit |
Nanostring Technologies, Inc |
GMX-PRO-MORPH-HST-12; Item 121300310 |
| Alexa Fluor® 647 alpha-Smooth Muscle Actin Antibody, clone 1A4 |
Novus Bio |
IC1420R |
|
| Biological samples |
|
| Autopsy tissues |
Weill Cornell Medicine Department of Pathology |
https://pathology.weill.cornell.edu/ |
|
| Chemicals, peptides, and recombinant proteins |
|
| TRIzol |
Invitrogen |
Cat. #15596026 |
| 10% neutral buffered Formalin |
Electron Microscopy Sciences |
Cat. #15712 |
| DNAse I |
Zymo Research |
Cat. #E1010 |
|
| Critical commercial assays |
|
| Super-Script III Platinum SYBR Green One-Step qRT-PCR Kit |
Invitrogen |
Cat. #12594025 |
| BD Univeral Viral Transport Media System |
Becton, Dickinson and Company |
Cat. #220526 |
| QIAsymphony DSP Virus/Pathogen Mini Kit |
Qiagen |
Cat. #937036 |
| NEBNext® rRNA Depletion Kit v2 (Human/Mouse/Rat) with RNA Sample Purification Beads |
New England BioLabs |
Cat. #E7405 |
| NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina |
New England BioLabs |
Cat. #E7760 |
| TapeStation 2200 |
Agilent Technologies |
Cat. #G2964AA |
| Kapa Biosystems Illumina library quantification kit |
Roche |
Cat. 07960140001 |
| GeoMx DSP system |
Nanostring Technologies, Inc |
MAN-10088-03 |
|
| Deposited data |
|
| Raw and analyzed RNA-seq data |
This paper |
dbGAP: accession #38851 and ID phs002258.v1.p1 |
| Analyzed Nanostring GeoMx data |
This paper |
GEO: GSE169504
|
| Human reference genome NCBI build 38, Gencode Human Release 33 (GRCH38.p13) |
Genome Reference Consortium |
http://www.ncbi.nlm.nih.gov/projects/genome/assembly/grc/human/ |
| Raw RNA-seq data |
Rother et al.44
|
GSE159678 |
| Reference scRNA-seq data |
Travaglini et al.45; MacParland et al.46; Stewart et al.47; Wang et al.8
|
https://www.humancellatlas.org/ |
| Molecular Signatures for GSEA (MSigDB) |
Liberzon et al.48; Subramanian et al.49; Kuleshov et al.50; Sergushichev et al., 2016 |
http://www.gsea-msigdb.org/gsea/ |
|
| Oligonucleotides |
|
| Primers for RT-PCR; ACTB-Forward: CGTCACCAACTGGGACGACA |
This paper |
N/A |
| Primers for RT-PCR; ACTB-Reverse: CTTCTCGCGGTTGGCCTTGG |
This paper |
N/A |
| Primers for RT-PCR; SARS-CoV-2-TRS-L: CTCTTGTAGATCTGTTCTCTAAACGAAC |
This paper |
N/A |
| Primers for RT-PCR; SARS-CoV-2-TRS-N: GGTCCACCAAACGTAATGCG |
This paper |
N/A |
|
| Software and algorithms |
|
| ImageJ |
Schneider et al., 2012 |
https://imagej.nih.gov/ij/ |
| nf-core/rnaseq pipeline |
Ewels et al.51
|
https://nf-co.re/rnaseq |
| FastQC |
Andrews52
|
https://www.bioinformatics.babraham.ac.uk/projects/fastqc/ |
| Trim Galore! |
N/A |
https://github.com/FelixKrueger/TrimGalore |
| STAR |
Dobin et al.53
|
https://github.com/alexdobin/STAR |
| Salmon |
Patro et al.54
|
https://salmon.readthedocs.io/en/latest/salmon.html |
| Picard |
N/A |
https://github.com/broadinstitute/picard |
| StringTie |
Kovaka et al.55
|
https://ccb.jhu.edu/software/stringtie/ |
| Samtools |
Li and Durbin56
|
http://samtools.sourceforge.net/ |
| DESeq2 R package |
Love et al.57
|
https://bioconductor.org/packages/release/bioc/html/DESeq2.html |
| MuSiC R package |
Wang et al.58
|
https://xuranw.github.io/MuSiC/articles/MuSiC.html |
| quanTIseq R package |
Finotello et al.59
|
https://icbi.i-med.ac.at/software/quantiseq/doc/ |
| Cocor R package |
Diedenhofen and Musch60
|
https://cran.r-project.org/web/packages/cocor/cocor.pdf |
| synRNASeqNet R package |
Luciano Garofano |
https://github.com/cran/synRNASeqNet |
|
| Other |
|
| Resource page to visualize and explore autopsy RNA-seq data |
This paper |
https://covidgenes.weill.cornell.edu |