Supplementary Table 1.
The rare and potential pathogenic variants in the patient with acephalic spermatozoa syndrome
| Variants | Homozygous/heterozygous | rs | gnomAD_exome_ALL | SIFT | Mutation Taster | Fathmm-MKL |
|---|---|---|---|---|---|---|
| AP5Z1:NM_014855:exon17:c.G2344A:p.D782N | Heterozygous | rs751001042 | 0.00006587 | Damaging | Disease_causing | Damaging |
| AP5Z1:NM_014855:exon12:c.C1567T:p.R523C | Heterozygous | rs201067711 | 0.0001 | Damaging | Disease_causing | Damaging |
| ARSD:NM_001669:exon5:c.T719G:p.F240C | Heterozygous | rs143238998 | 0.000008385 | Tolerable | Neutral | Neutral |
| ARSD:NM_001669:exon5:c.G713T:p.C238F | Heterozygous | rs150899882 | 0.000008362 | Tolerable | Neutral | Neutral |
| BCOR:NM_001123383:exon4:c.C494T:p.A165V | Homozygous | rs538820529 | 0.00007279 | Damaging | Neutral | Damaging |
| BPTF:NM_004459:exon1:c.G149T:p.R50M | Heterozygous | . | 0 | Damaging | Neutral | Neutral |
| BPTF:NM_004459:exon1:c.G152T:p.W51L | Heterozygous | . | 0 | Tolerable | Neutral | Neutral |
| C2CD4B:NM_001007595:exon2:c.G389A:p.C130Y | Heterozygous | . | 0 | Tolerable | Neutral | Neutral |
| C2CD4B:NM_001007595:exon2:c.G386C:p.S129T | Heterozygous | . | 0 | Tolerable | Neutral | Neutral |
| CXorf67:NM_203407:exon1:c.G1504A:p.E502K | Homozygous | rs781789803 | 0.00005147 | Damaging | Neutral | Neutral |
| ESX1:NM_153448:exon4:c. 1105_1131del:p.369_377del | Homozygous | . | 0.0000341 | NA | NA | NA |
| GRIK5:NM_002088:exon19:c.C2809T:p.R937W | Heterozygous | . | 0 | Damaging | Disease_causing | Damaging |
| GRIK5:NM_002088:exon19:c.G2807T:p.C936F | Heterozygous | . | 0 | Damaging | Disease_causing | Damaging |
| HSFX3:NM_001323079:exon2:c.G988A:p.D330N | Homozygous | rs372261595 | 0 | NA | NA | NA |
| KRTAP5-7:NM_001012503:exon1:c.329_330insCTG CTGCCAGTCCAGCTGCTGTAAGCCCTGCTGCTGCCAGTCC AGCTGCTGTAAGCCCTG:p.S110delinsSCCQSSCCKPCCCQSSCCKPC | Homozygous | . | 0 | NA | NA | NA |
| MRE11:NM_001330347:exon4:c.A310T:p.S104C | Homozygous | rs748434421 | 0.00000407 | Damaging | Disease_causing | Damaging |
| MUC16:NM_024690:exon55:c.G40588A:p.G13530S | Heterozygous | . | 0 | Tolerable | Neutral | Neutral |
| MUC16:NM_024690:exon46:c.A39683C:p.K13228T | Heterozygous | . | 0 | Damaging | Neutral | Neutral |
| NOX4:NM_001291929:exon10:c.T947C:p.L316P | Homozygous | . | 0 | Damaging | Disease_causing | Damaging |
| PCSK1N:NM_013271:exon1:c.G23T:p.W8L | Heterozygous | . | 0 | Tolerable | Neutral | Neutral |
| PCSK1N:NM_013271:exon1:c.G7T:p.G3W | Heterozygous | . | 0 | Tolerable | Neutral | Neutral |
| PRDM2:NM_001007257:exon3:c.246_247del:p.D82fs | Heterozygous | rs776947041 | 0.0006 | NA | NA | NA |
| PRDM2:NM_001007257:exon3:c.249delT:p.D83fs | Heterozygous | rs770299670 | 0.0005 | NA | NA | NA |
| RPLP0:NM_001002:exon8:c.C838A:p.P280T | Heterozygous | . | 0.000004119 | Tolerable | Disease_causing | Damaging |
| RPLP0:NM_001002:exon8:c.C851A:p.A284D | Heterozygous | . | 0 | Damaging | Disease_causing | Damaging |
| SLC2A14:NM_001286236:exon5:c.C413T:p.T138M | Heterozygous | rs778496220 | 0.00008533 | Damaging | Neutral | Neutral |
| SLC2A14:NM_001286236:exon4:c.C64T:p.L22F | Heterozygous | rs751861316 | 0.00004062 | Tolerable | Disease_causing | Neutral |
| SPATC1L:NM_001142854:exon5:c.G994T:p.E332X | Heterozygous | rs553752275 | 0.00004149 | NA | Disease_causing | Neutral |
| SPATC1L:NM_001142854:exon5:c.C910T:p.R304C | Heterozygous | rs755224454 | 0.00001716 | Damaging | Disease_causing | Damaging |
| TBL1Y:NM_134258:exon7:c.G413A:p.R138Q | Homozygous | rs377026718 | 0.0003 | Tolerable | NA | Damaging |
| TPRN:NM_001128228:exon1:c.G174T:p.E58D | Heterozygous | . | 0 | Damaging | Neutral | Damaging |
| TPRN:NM_001128228:exon1:c.G161T:p.G54V | Heterozygous | . | 0 | Damaging | Disease_causing | Damaging |
NA: not available; SIFT: sorting intolerant from tolerant