Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Example of top 5 gRNAs for Cas9. The model is DeepHF WT R E
| Start | Sequence | Strand | Mean | Variance |
|---|---|---|---|---|
| 5273 | GGATCAGCTAGAGAAAGGAGGGG | + | 0.9344 | 0.0122 |
| 12819 | CAGCGGCATGAACCCCACCGTGG | - | 0.9310 | 0.0120 |
| 10683 | TCATGGCAGAAAGAATGGAGAGG | + | 0.9230 | 0.0119 |
| 7403 | GTGTGTGGACAGATCAGGAGGGG | - | 0.9264 | 0.0119 |
| 4807 | AGAGACAAAGTTCCCACCAGGGG | - | 0.9260 | 0.0119 |
