Figure 7.

Comparison of free energy levels for linear ssDNA, lh-DNA (including Z-DNA), and B-DNA with the same sequence. Here, the sequence of 5′-d(AGCTAGAGCAGAGCAGGAATTCAGAGTGAGAGAGCGAGA)-3′ is used as an example. Suppose the absolute free energy for B-DNA is X kcal/mol, the corresponding free energy (at 25°C) of ssDNA is calculated by mfold to be X + 53.2 kcal/mol under the following conditions. ([dsDNA] = 1.0 μM, [Na⁺] = 10 mM, [Mg²⁺] = 10 mM). Suppose T_m for lh-DNA (T_m = 73–75.4°C) is 3∼6°C lower than B-DNA (T_m = 78.7°C), the free energy of lh-DNA should be X + 5.3–8.4 kcal/mol).