Skip to main content
The Journal of Biological Chemistry logoLink to The Journal of Biological Chemistry
. 2022 Jan 5;298(2):101562. doi: 10.1016/j.jbc.2022.101562

Hypoxia inhibits colonic uptake of the microbiota-generated forms of vitamin B1 via HIF-1α-mediated transcriptional regulation of their transporters

Subrata Sabui 1,2, Kalidas Ramamoorthy 1, Jose M Romero 2,3, Rita D Simoes 4, James M Fleckenstein 4,5, Hamid M Said 1,2,3,
PMCID: PMC8800108  PMID: 34998824

Abstract

Hypoxia exerts profound effects on cell physiology, but its effect on colonic uptake of the microbiota-generated forms of vitamin B1 (i.e., thiamin pyrophosphate [TPP] and free thiamine) has not been described. Here, we used human colonic epithelial NCM460 cells and human differentiated colonoid monolayers as in vitro and ex vivo models, respectively, and were subjected to either chamber (1% O2, 5% CO2, and 94% N2) or chemically (desferrioxamine; 250 μM)-induced hypoxia followed by determination of different physiological–molecular parameters. We showed that hypoxia causes significant inhibition in TPP and free thiamin uptake by colonic NCM460 cells and colonoid monolayers; it also caused a significant reduction in the expression of TPP (SLC44A4) and free thiamin (SLC19A2 and SLC19A3) transporters and in activity of their gene promoters. Furthermore, hypoxia caused a significant induction in levels of hypoxia-inducible transcription factor (HIF)-1α but not HIF-2α. Knocking down HIF-1α using gene-specific siRNAs in NCM460 cells maintained under hypoxic conditions, on the other hand, led to a significant reversal in the inhibitory effect of hypoxia on TPP and free thiamin uptake as well as on the expression of their transporters. Finally, a marked reduction in level of expression of the nuclear factors cAMP responsive element–binding protein 1 and gut-enriched Krüppel-like factor 4 (required for activity of SLC44A4 and SLC19A2 promoters, respectively) was observed under hypoxic conditions. In summary, hypoxia causes severe inhibition in colonic TPP and free thiamin uptake that is mediated at least in part via HIF-1α-mediated transcriptional mechanisms affecting their respective transporters.

Keywords: hypoxia, vitamin B1 uptake, human differentiated colonoid monolayers, HIF-1α

Abbreviations: CREB, cAMP responsive element–binding protein; cTPPT, colonic TPP transporter; DFO, desferrioxamine; Elf-3, E74-like ETS transcription factor 3; GKLF-4, gut-enriched Krüppel-like factor 4; HIF, hypoxia-inducible transcription factor; HRE, hypoxia-responsive element; IBD, inflammatory bowel disease; LDHA, lactate dehydrogenase A; NF-1, neurofibromatosis-1; PGK-1, phosphoglycerate kinase 1; qPCR, quantitative PCR; SP-1, specificity protein 1; THTR-1, thiamin transporter-1; THTR-2, thiamin transporter-2; TPP, thiamin pyrophosphate


Vitamin B1, a water-soluble micronutrient, is essential for normal physiology and health of all human/mammalian cells. In its predominant and biologically active form, that is, thiamin pyrophosphate (TPP), the vitamin plays indispensable roles in oxidative energy metabolism–ATP production and in reduction of cellular oxidative stress. Thus, it is not surprising that deficiency of vitamin B1 at the cellular and systemic levels negatively impacts cell physiology and overall host health. At the cellular level, such deficiency leads to impairment in oxidative energy metabolism, ATP production, disruption in mitochondrial function (mitochondria utilize ∼90% of cellular TPP), oxidative stress, and apoptosis (1, 2, 3, 4, 5). At the systemic level, the deficiency leads to a variety of clinical abnormalities (e.g., neurological and cardiovascular disorders). Vitamin B1 deficiency is not uncommon and occurs in different conditions, including inflammatory bowel disease (IBD) (6), sepsis (7), chronic alcoholism (8, 9), bariatric surgery (10), and diabetes mellitus (11). Optimizing thiamin body level/homeostasis, on the other hand, has been shown to be beneficial in treating disorders like sepsis/septic shock (7, 12) and thiamin-responsive megaloblastic anemia (13); it also reduces fatigue in IBD patients (14).

Humans and other mammals obtain vitamin B1 (via intestinal absorption) from exogenous sources as they cannot synthesize it endogenously. Two sources of thiamin are available to the gut: diet and the gut microbiota (15, 16, 17, 18, 19, 20). In the diet, vitamin B1 exists in both the free and phosphorylated forms; the latter form is enzymatically converted (by the action of small intestinal phosphatases) to the free form (i.e., free thiamin) prior to absorption (reviewed in Ref. (20)). Free thiamin is then absorbed by a specific carrier-mediated mechanism that involves two transporters: thiamin transporter-1 (THTR-1) and thiamin transporter-2 (THTR-2); products of the SLC19A2 and SLC19A3 genes, respectively; reviewed in Ref. (21)). Microbiota-generated vitamin B1 provides both free thiamin and TPP forms (15, 16, 17), and several phyla (including Bacteroidetes [Bacteroides fragilis and Prevotella copri], Firmicutes [Clostridium difficile, Ruminococcus lactaris, and some Lactobacillus sp.], Actinobacteria [Bifidobacterium sp.], and Fusobacter [Fusobacterium varium]) appear to be the main producers of the vitamin (22). Studies with human subjects and rodents have shown that the large intestine is capable of absorbing luminal vitamin B1 (reviewed in Ref. (17); also Refs. (18, 23, 24)). This was confirmed in studies in our laboratory utilizing human colonic epithelial cells and colonic apical membrane vesicle preparations isolated from the colon of organ donors (19, 25, 26). The latter studies have shown that colonic uptake of free thiamin is similar to that in the small intestine and occurs via a carrier-mediated process that involves THTR-1 and THTR-2 (19). Colonic uptake of TPP, on the other hand, was found to occur via a distinct and an efficient carrier-mediated process that involves the colonic TPP transporter (cTPPT; product of the SLC44A4 gene (25, 26)). Expression of the cTPPT in the intestinal tract is limited to the large bowel (27, 28) and occurs exclusively at the apical membrane domain of the lining polarized epithelia (25, 26, 27). Since colonocytes have limited ability to generate TPP intracellularly (they express a very low level of the required enzyme, that is, TPKase; (28)), the cTPPT system appears to be of dual importance: it provides the metabolically active colonocytes with their need of an already synthesized TPP and also contributes toward total body nutrition/homeostasis of vitamin B1 (29, 30).

Epithelial cells lining the intestinal tract are exposed to changing levels of oxygen because of their juxtaposition to the oxygen-depleted (anerobic/anoxic) gut lumen and because of the constantly changing rates of oxygen demand/supply (31, 32). This austere microenvironment (considered to be among the most severe in mammalian tissues) leads to a state of hypoxia even under physiologic conditions. Inflammation in the colonic and small intestinal mucosa (as in IBD), however, leads to the development of a more profound and severe form of hypoxia, the so-called pathophysiologic hypoxia (31, 32, 33, 34). Pathophysiologic hypoxia exerts profound effects on the cell physiology including their transport functions; the effect on the latter, however, is differential, and both stimulation and inhibition have been reported (35, 36, 37, 38, 39, 40). Nothing is currently known about the effect of hypoxia on colonic uptake of microbiota-generated vitamin B1 forms (i.e., TPP and free thiamine). We addressed this issue using an in vitro (human colonic epithelial NCM460 cells) and an ex vivo (human differentiated colonoid monolayers) model. Our results showed that hypoxia causes significant inhibition in colonic uptake of TPP and free thiamin. This inhibition is associated with a marked reduction in level of expression of cTPPT, THTR-1, and THTR-2 and appears to be mediated (at least in part) via transcriptional mechanism(s) involving the SLC44A4, SLC19A2, and SLC19A3 genes.

Results

Effect of hypoxia on colonic uptake of TPP and free thiamin

Effect of chamber-induced hypoxia

In these studies, we used in vitro and ex vivo models to examine the effect of chamber-induced hypoxia on colonic carrier–mediated uptake of TPP and free thiamin. In the in vitro model, we exposed human colonic epithelial NCM460 cells to hypoxia by maintaining the cells for 16 h in a hypoxic chamber (see the “Experimental procedures” section). First, we verified that hypoxia was induced in the cells incubated under the hypoxic condition by assessing the level of expression of a positive internal control: phosphoglycerate kinase 1 (PGK-1), an enzyme is known to be induced under hypoxic conditions (41). The results showed a marked induction in level of mRNA expression of marker genes in cells incubated under hypoxic compared with normoxic conditions (mRNA levels of PGK-1 were 100 ± 20 and 370 ± 10 in cells maintained under normoxic and hypoxic conditions, respectively. p < 0.05). We then examined the effect of chamber-induced hypoxia on initial rate of carrier-mediated uptake of TPP (0.23 μM) and free thiamin (15 nM) in NCM460. Hypoxia resulted in significant (p < 0.01 for both) inhibition in cellular uptake of both TPP and free thiamin relative to normoxia (Fig. 1, A-[i] and B-[i]). In both cases, the inhibition was found to be associated with a marked reduction in level of expression of the involved transporters (i.e., cTPPT for TPP and THTR-1 and THTR-2 for free thiamin) at both the protein and mRNA levels (Fig. 1, A-[ii] and [iii] and B-[ii]–[v]).

Figure 1.

Figure 1

Effect of chamber-induced hypoxia on TPP and free thiamin uptake by human colonic epithelial NCM460 cells. Cells were exposed to chamber-induced hypoxia for 16 h. A, effect of hypoxia on [i] carrier-mediated [3H]-TPP uptake; [ii] and [iii] level of expression of cTPPT protein and mRNA, respectively. B, effect of hypoxia on [i] carrier-mediated [3H]-thiamin uptake; [ii] and [iii] level of expression of THTR-1 and THTR-2 proteins (immunoblot); and [iv] and [v] level of expression of THTR-1 and THTR-2 mRNAs (RT–qPCR), respectively. All protein and mRNA results were normalized relative to GAPDH, and comparison was made relative to simultaneously performed controls (normoxia). Statistical significance of uptake (n = 6; ∗∗p < 0.01), protein (n = 4; ∗∗p < 0.01), and mRNA (n = 3; ∗∗p < 0.01) was evaluated by the Student's t test. cTPPT, colonic TPP transporter; THTR-1, thiamin transporter-1; THTR-2, thiamin transporter-2; TPP, thiamin pyrophosphate; qPCR, quantitative PCR.

To establish translational relevance to the findings on the effect of hypoxia on colonic carrier–mediated TPP and free thiamin uptake observed with cultured NCM460 cells, we examined the effect of chamber-induced hypoxia on carrier-mediated uptake of these two forms of vitamin B1 using the ex vivo human differentiated colonoid monolayers. The results again showed significant inhibition in carrier-mediated TPP (p < 0.05) and free thiamin (p < 0.01) uptake by colonoid monolayers maintained under hypoxic compared with normoxic conditions. This inhibition was similarly associated with a significant reduction in mRNA expression of the respective transporters (for cTPPT, p < 0.01; THTR-1, p < 0.01; and THTR-2, p < 0.05) in hypoxia-exposed colonoid monolayers compared with normoxia (Fig. 2, A and B).

Figure 2.

Figure 2

Effect of chamber-induced hypoxia on TPP and free thiamin uptake by human differentiated colonoid monolayers. Colonic monolayers were exposed to chamber-induced hypoxia for 16 h. A, effect of hypoxia on [i] colonic carrier–mediated [3H]-TPP uptake; [ii] level of expression of cTPPT mRNA. B, effect of hypoxia on [i] colonic carrier–mediated [3H]-thiamin uptake; [ii] and [iii] level of expression of THTR-1 and THTR-2 mRNAs, respectively. All mRNA results were normalized relative to GAPDH, and comparison was made relative to simultaneously performed controls (normoxia). Statistical significance of all uptake and mRNA data (n = 3 for all; ∗∗p < 0.01; ∗p < 0.05, respectively) was evaluated by the Student's t test. cTPPT, colonic TPP transporter; THTR-1, thiamin transporter-1; THTR-2, thiamin transporter-2; TPP, thiamin pyrophosphate.

Taken together, the aforedescribed findings show that exposure of human colonic epithelial cells to hypoxia significantly impairs uptake of the microbiota-generated TPP and free thiamin and that the effect is mediated via reduction in level of expression of their respective uptake systems.

Effect of chemically induced hypoxia

In these studies, we examined the effect of chemically induced hypoxia on initial rate of colonic carrier–mediated uptake of TPP and free thiamin. For this, we treated human colonic epithelial NCM460 cells with the hypoxia-mimetic agent desferrioxamine (DFO) (250 μM for 48 h; (38)) followed by transport investigations. First, we verified induction of hypoxia in the DFO-treated cells by assessing level of expression of two positive internal controls: lactate dehydrogenase A (LDHA) and PGK-1 (41). DFO treatment resulted in a marked induction in mRNA expression of both enzymes compared with untreated control cells. (Relative expression levels of LDHA: 100 ± 5 and 598 ± 33 and PGK-1: 100 ± 2.4 and 650 ± 18 in control and DFO-treated cells, respectively; p < 0.01 for both). We then examined the effect of chemically induced hypoxia on carrier-mediated TPP (0.23 μM, 7 min) and free thiamin (15 nM, 10 min) uptake. Again, we observed significant (p < 0.05 for both) inhibition in carrier-mediated TPP and free thiamin uptake in DFO-treated cells compared with untreated controls (Fig. 3, A-[i] and B-[i]). This inhibition was associated with marked (p < 0.01 for all) reduction in level of mRNA expression of cTPPT, THTR-1, and THTR-2 in hypoxic compared with normoxic cells (Fig. 3, A-[ii] and B-[ii]–[iii]).

Figure 3.

Figure 3

Effect of chemically induced hypoxia on uptake of TPP and free thiamin by human colonic epithelial NCM460 cells. Cells were treated with the hypoxia-mimetic agent DFO (250 μM) for 48 h. A, effect of hypoxia on [i] colonic carrier–mediated [3H]-TPP uptake and [ii] level of expression of cTPPT mRNA. B, effect of hypoxia on [i] colonic carrier–mediated [3H]-thiamin uptake; [ii] and [iii] level of expression of THTR-1 and THTR-2 mRNA, respectively. All mRNA results were normalized relative to GAPDH, and comparison was made relative to simultaneously performed controls (normoxia). Statistical significance of uptake (n = 4; ∗p < 0.05) and mRNA (n = 4; ∗∗p < 0.01) was evaluated by the Student's t test. cTPPT, colonic TPP transporter; DFO, desferrioxamine; THTR-1, thiamin transporter-1; THTR-2, thiamin transporter-2; TPP, thiamin pyrophosphate.

Collectively, the aforementioned findings show that chamber-induced and chemically induced hypoxia inhibits colonic carrier–mediated uptake of TPP and free thiamin, and that the inhibition is associated with reduction in level of expression of TPP and free thiamin transporters.

Effect of hypoxia on the activity of the SLC44A4, SLC19A2, and SLC19A3 gene promoters in colonic epithelial cells: involvement of transcriptional mechanism(s)

The aforeobserved inhibition in colonic carrier–mediated uptake of TPP and free thiamin and in the level of mRNA expression of the involved transporters suggests possible involvement of transcriptional mechanism(s) involving the SLC44A4, SLC19A2, and SLC19A3 genes. To test this possibility, we exposed colonic epithelial NCM460 cells transfected with SLC44A4, SLC19A2, and SLC19A3 full-length (as well as minimal) promoters fused to the luciferase reporter gene to chamber-induced hypoxia followed by examination of promoter activities. Exposure of cells to hypoxia resulted in significantly (p < 0.01 for all) reduced activity of SLC44A4, SLC19A2, and SLC19A3 full-length (as well as minimal) promoters compared with normoxic conditions (Fig. 4, AC). These findings suggest that transcriptional mechanisms mediate the effects of hypoxia on carrier-mediated TPP and free thiamin uptake by human colonocytes. The data also demonstrate that the hypoxia-responsive regions are in the minimal promoter regions of these genes.

Figure 4.

Figure 4

Effect of exposure of human colonic epithelial NCM460 cells to chamber-induced hypoxia on promoter activity.A, SLC44A4; B, SLC19A2; and C, SLC19A3 genes. Full-length and minimal-promoter constructs of the respective genes in pGL3 basic vector with pRLTK plasmid were transfected into NCM460 cells. Forty-eight hours following transfection, cells were exposed to chamber-induced hypoxia for additional 16 h followed by the determination of luciferase activity. All luciferase activities were normalized relative to PGL3 basic vector, and comparison was made relative to simultaneously performed controls (normoxia). Statistical significance of all data (n = 8 for all; ∗∗p < 0.01) were evaluated by the Student’s t test. pRLTK, thymidine kinase promoter-Renilla luciferase.

Effect of chamber-induced hypoxia on level of expression of hypoxia-inducible transcription factors in human colonocytes

Cellular responses to hypoxia are primarily mediated by hypoxia-inducible transcription factors (HIFs), especially HIF-1α and HIF-2α (42, 43). In this study, we examined the effect of chamber-induced hypoxia on level of expression of these factors in human colonic epithelial NCM460 cells. First, we subjected the SLC44A4, SLC19A2, and SLC19A3 minimal promoter regions to computer analysis (Eukaryotic Promoter Database; https://epd.epfl.ch//index.php) to determine if they contain putative hypoxia-responsive element (HRE)–binding sites (i.e., “R-CGTG”). The computational analysis predicted the SLC44A4 and SLC19A2 minimal promoters to contain one putative HRE sequence at position −55 and −141, respectively. The minimum promoter of SLC19A3, on the other hand, was found to contain three such putative HRE sequences located at positions −44, −47, and −73 (Fig. 5A). We then examined (by immunoblotting) the effect of chamber-induced hypoxia on level of expression of HIF-1α and HIF-2α proteins in human colonic epithelial NCM460 cells; results were compared with their level of expression in control cells maintained under normoxic condition. Detectable levels of HIF-1α in hypoxic cells (but not those maintained under normoxic condition) increased with time with hypoxia (Fig. 5B-[i]). On the other hand, the very low level of HIF-2α protein detected in colonic NCM460 cells maintained under hypoxic conditions was similar to that in cells maintained under control (normoxic) conditions (Fig. 5B-[ii]). These findings suggest a role for HIF-1α in mediating the inhibitory effect of hypoxia on colonic uptake of TPP and free thiamin.

Figure 5.

Figure 5

Effect of hypoxia on chamber-induced hypoxia on level of expression of hypoxia-inducible factors (HIFs) in human colonic epithelial NCM460 cells.A, schematic representation of the [i] SLC44A4, [ii] SLC19A2, and [iii] SLC19A3 minimal promoter regions depicting predicted binding sites for HREs. B, NCM460 cells were exposed to chamber-induced hypoxia for 16 h followed by examination of HIF expression. Level of expression of HIF-1α and HIF-2α protein (immunoblot) in hypoxia-exposed cells compared with those exposed to normoxia (control) condition. All protein results were normalized relative to GAPDH. Statistical significance of all proteins (n = 3; ∗p < 0.05) was evaluated using the Student's t test. HRE, hypoxia-responsive element.

Role of HIF-1α in mediating the inhibitory effect of hypoxia on colonic uptake of TPP and free thiamin and on expression of cTPPT, THTR-1, and THTR-2

To further confirm the contribution of HIF-1α in mediating the inhibitory effect of hypoxia on carrier-mediated colonic TPP and free thiamin uptake and expression of their relevant transporters, we examined the effect of siRNA silencing on the HIF-1α gene (44) in NCM460 cells maintained under chamber-induced hypoxia on their ability to take up TPP and free thiamin. First, we established that in hypoxic NCM460 cells, HIF-1α gene-specific siRNA leads to significant (p < 0.01) inhibition in level of expression of HIF-1α protein (Fig. 6A). Under chamber-induced hypoxia, HIF-1α-specific siRNA treatment of NCM460 cells led to a significant (p < 0.01–0.05) recovery in transport of both TPP and free thiamin substrates relative to uptake by cells treated with scrambled siRNAs (Fig. 6, B and C). Similarly, expression of the corresponding cTPPT (p < 0.05), THTR-1 (p < 0.01), and THTR-2 (p < 0.01) proteins was enhanced under hypoxic conditions in NCM460 cells pretreated with HIF-1α siRNAs compared with cells pretreated with scrambled siRNA (Fig. 6, DF). These findings demonstrate that HIF-1α mediates the inhibitory effects of hypoxia on colonic carrier–mediated uptake of TPP and free thiamin and on levels of expression of their relevant transporters.

Figure 6.

Figure 6

Effect of hypoxia on knocking down HIF-1α with gene-specific siRNA on the inhibitory effect of hypoxia on uptake of TPP and free thiamin and on the level of expression of cTPPT, THTR-1, and THTR-2 in human colonic epithelial NCM460 cells. Cells were transfected with prevalidated HIF-1α-specific or scrambled (nontargeting negative control) siRNAs (42) as described in the Experimental procedures section. Twenty four hours following transfection, cells were exposed to normoxic or hypoxic conditions for an additional 16 h. A, immunoblot showing the effect of transfection with HIF-1α-specific and scrambled siRNAs on level of expression of the HIF-1α protein (probing was done using specific anti-HIF-1α antibody). B, initial rate (7 min) of carrier-mediated [3H]-TPP uptake. C, initial rate (10 min) of carrier-mediated [3H]-thiamin uptake. DF, level of expression of cTPPT, THTR-1, and THTR-2 proteins (immunoblot) probed with the transporter-specific antibodies (see the Experimental procedures section). All protein results were normalized relative to GAPDH, and comparison was made relative to simultaneously performed controls (normoxia). Statistical significance of uptake (n = 4; ∗∗p < 0.01; ∗p < 0.05) and protein (n = 3; ∗∗p < 0.01; ∗p < 0.05) data was evaluated by the Student's t test. cTPPT, colonic TPP transporter; HIF-1α, hypoxia-inducible transcription factor 1α; THTR-1, thiamin transporter-1; THTR-2, thiamin transporter-2; TPP, thiamin pyrophosphate.

Effect of hypoxia on expression of nuclear factors required for basal activity of the SLC44A4, SLC19A2, and SLC19A3 gene promoters

The aforedescribed studies demonstrate that hypoxia negatively impacts colonic uptake of TPP and free thiamin as well as expression of their transporters, and that the effect is mediated via transcriptional modulation of the SLC44A4, SLC19A2, and SLC19A3 genes. Whether part of the effect of hypoxia on transcription of these genes is also mediated through inhibited expression of nuclear factor(s) required for basal activity of their promoters is not clear. Thus, we examined the effect of chamber-induced hypoxia on level of expression of the transcription factors cAMP responsive element–binding protein (CREB), E74-like ETS transcription factor 3 (Elf-3), specificity protein 1 (SP-1), gut-enriched Krüppel-like factor 4 (GKLF-4), and neurofibromatosis-1 (NF-1) in human colonic NCM460 cells as well as human differentiated colonoid monolayers. We focused on these transcription activators because previous studies from our laboratory have shown that the minimal promoter regions of the SLC44A4, SLC19A2, and SLC19A3 genes contain cis-elements for these nuclear factors that are important for their activity (the minimal promoter region of SLC44A4 contains CREB [−35] and Elf-3 [−77]; that of SLC19A2 contains SP-1 [−238], GKLF-4 [−305], NF-1 [−350]; and that of SLC19A3 contains an SP-1 [−45]) (43, 44, 45). Results of the quantitative PCR (qPCR) analysis showed significant (p < 0.01 for both) reduction in level of mRNA expression of the CREB-1 and GKLF-4 (but not that of Elf-3, SP-1, or NF-1A) in human colonic epithelial NCM460 cells (Fig. 7A) as well as human colonoid monolayers (Fig. 7B) maintained under hypoxic condition compared with those maintained under normoxic condition.

Figure 7.

Figure 7

Effect of chemically induced hypoxia on expression of transcription factors (TFs) that regulate activity of the SLC44A4, SLC19A2, and SLC19A3 gene promoters.A, human colonic epithelial NCM460 cells. B, human differentiated colonoid monolayers. NCM460 cells and human differentiated colonoid monolayers were exposed to hypoxic (or normoxic) conditions, followed by determination of levels of mRNA expression of the TFs CREB-1 and Elf-3 (for SLC44A4 promoter) as well as SP1, GKLF4, and NF-1A (for SLC19A2 and SLC19A3 promoters). All mRNA expression data were normalized relative to GAPDH and compared with their respective controls (n = 3; ∗∗p < 0.01). Statistical significance was evaluated by Student’s t test. CREB-1, cAMP responsive element–binding protein 1; Elf-3, E74-like ETS transcription factor 3; GKLF-4, gut-enriched Kruppel-like factor 4; NF-1A, neurofibromatosis-1A; NS, not significant; SP1, specificity protein 1.

Discussion

Our aims in these investigations were to examine the effects of pathophysiological hypoxia on colonic uptake of the microbiota-generated TPP as well as free thiamin. As mentioned earlier, hypoxia exerts profound effects on cell physiology including transport events at their cell membranes (35, 36, 37, 38, 39, 40). Nothing, however, is known about the effect of hypoxia on colonic uptake of vitamin B1, a micronutrient that is essential for cellular energy metabolism/ATP production, mitochondrial function, and for reduction of oxidative stress (1, 2, 3, 4). We investigate this issue utilizing two complementary models of human colonic epithelial cells: an in vitro (human epithelial NCM460 cells) and an ex vivo (human differentiated colonoid monolayers) model. Also, we employed two models of hypoxia in our investigations: chamber-induced as well as chemically induced hypoxia.

Results of our investigations showed that exposure of human colonic epithelial NCM460 cells to chamber-induced or to chemically induced hypoxia lead to a significant inhibition in carrier-mediated TPP and free thiamin uptake. This inhibition was associated with a significant reduction in level of expression of cTPPT as well as THTR-1 and THTR-2 proteins and mRNAs. Similar findings were observed when human differentiated colonoid monolayers were exposed to chamber-induced hypoxia, where a significant inhibition in carrier-mediated TPP and free thiamin uptake occurred that was associated with a significant reduction in level of expression of cTPPT and THTR-1 and THTR-2.

The inhibitory effects of hypoxia on colonic TPP and free thiamin uptake and expression of their transporters were found to be mediated (at least in part) via transcriptional mechanisms affecting the respective genes of the involved transporters. This was evident from the results of studies of the effect of chamber-induced hypoxia on activity of the SLC44A4, SLC19A2, and SLC19A3 promoters (both full-length and minimal promoters), where significant inhibition in activity of these promoters was observed in colonic epithelial cells exposed to hypoxia compared with those maintained under normoxic conditions. The fact that hypoxia caused a similar degree of inhibition in activity of full-length as well as minimal promoters of these genes suggests that the HREs are located in latter regions. Indeed, interrogation of the minimal promoter regions of SLC44A4, SLC19A2, and SLC19A3 by the Eukaryotic Promoter Database program predicted existence of HREs in all these regions. Since cellular responses to hypoxia are mainly mediated by HIF-1α and HIF-2α (42, 43), we examined the effect of chamber-induced hypoxia on level of expression of these factors in human colonic epithelial NCM460 cells. The results showed induction in level of expression of HIF-1α (but not HIF-2α) in cells exposed to hypoxia, which increased with time. These findings suggested a role for HIF-1α in mediating the effect of hypoxia on colonic TPP and free thiamin uptake and expression of their respective transporters. The latter suggestion was confirmed in the study examining the effect of knocking down HIF-1α of NCM460 cells with gene-specific siRNAs on the hypoxia-mediated inhibition of TPP and free thiamin uptake and expression of their transporters. Indeed, a significant reversal in the inhibitory effect of hypoxia on colonic TPP and free thiamin uptake as well as on level of expression of cTPPT, THTR-1, and THTR-2 proteins was observed as a result of HIF-1α knockdown. These findings clearly establish a role for HIF-1α in mediating the inhibitory effect of hypoxia on colonic uptake of TPP and free thiamin.

Previous studies from our laboratory have established that transcription factors, CREB-1, Elf-3, GKLF4, NF-1, and SP1, play an important role in driving the activity of the SLC44A4, SLC19A2, and SLC19A3 promoters (45, 46, 47). Thus, we also examined whether part of the hypoxia effects on colonic TPP and free thiamin uptake and expression of their transporters could also involve suppression in level of expression of these nuclear factors. The results indeed showed significant suppression in level of expression of CREB-1 and GKLF-4 (with no effect on level of expression of Elf-3, SP-1, or NF-1A) in NCM460 cells and human differentiated colonoid monolayers exposed to hypoxia compared with those maintained under normoxic condition. These findings suggest possible involvement of CREB-1 and GKLF4 in mediating (part of) the inhibitory effect of hypoxia on cTPPT and THTR-1 expression and ultimately colonic TPP and thiamin uptake. Whether the reduction in level of expression of the latter transcription factors is mediated via HIF-1α or other hypoxia-mediated mechanisms is not known at this stage requires further investigations.

Our findings of inhibition in uptake of free thiamin and expression of its transporters in human colonocytes are in contrast to the stimulatory effect of hypoxia on vitamin B1 uptake and expression of THTR-1 observed in breast cancer cells (38). This suggests that the effects of hypoxia on vitamin B1 transport are cell specific in nature. In summary, our findings show for the first time that exposure of human colonocytes to hypoxia negatively impacts the transport physiology and molecular biology of TPP and free thiamin uptake processes. The results also show that these effects are mediated (at least in part) at the level of transcription of the SLC44A4, SLC19A2, and SLC19A3 genes.

Experimental procedures

Chemicals and reagents

[3H]-TPP (specific activity: >1.4 Ci/mmol; radiochemical purity: >98.2%) and [3H]-thiamin (specific activity: >12.8 Ci/mmol; radiochemical purity: >93.3%) were purchased from Moravek, Inc. Human-specific anti-TPPT (SLC44A4) affinity-purified rabbit polyclonal antibody was generated for us by Thermo Fisher Scientific; anti-THTR-1 (catalog no.: ab229680) rabbit polyclonal antibody was from Abcam; anti-THTR-2 (catalog no.: 13407-1-AP) rabbit polyclonal antibody was from Proteintech; anti-HIF-1α (catalog no.: 14179S) rabbit monoclonal antibody was from Cell Signaling Technology; anti-HIF-2α (catalog no.: NB100-122) rabbit polyclonal antibody was from Novus Biologicals; and anti-GAPDH mouse monoclonal antibody (catalog no.: sc-47724) was from Santa Cruz. The secondary antibodies, anti-rabbit IRDye-800 (catalog no.: 926-32211) and antimouse IRDye-680 (catalog no.: 926-68020), were purchased from LI-COR Bioscience. All other chemicals and reagents used in this studies were of analytical/molecular biology grade and purchased from established sources.

Culturing of human-derived colonic epithelial NCM460 cells and exposure to hypoxia

NCM460 cells were obtained from INCELL and maintained in M3 base culture medium, supplemented with fetal bovine serum (20%), penicillin (100 U/ml), and streptomycin (100 μg/ml) and incubated at 37 °C in 5% CO2 incubator as described before. Our selection of the NCM460 cells as the model in the current investigation is based on the fact that they are similar to native human colonic preparations in that they transport TPP and free thiamin via distinct and specific carrier-mediated processes (19, 21, 25, 26). Also, our findings on the effect of hypoxia were not unique to these cells but were also observed with the human colonic epithelial CCD 841 cells (data not shown). In these studies, we grew the NCM460 cells to 70 to 80% confluency, then maintained them (for the indicated periods) under either a standard normoxic, that is, control (humidified air with 5% CO2; ThermoFisher Forma Series II incubator) or hypoxic (1% O2, 94% N2, and 5% CO2; Thermo Scientific HERACELL150i incubator) conditions. Chemical hypoxia was induced in NCM460 cells by incubating them in the presence of 250 μM DFO (a hypoxic-memetic agent that chelates iron and prevents the degradation of HIF-1α protein leading to hypoxia; (38, 48)) for 48 h; control cells were run simultaneously and maintained in the absence of DFO.

Culturing of human differentiated colonoid monolayers and exposure to hypoxia

Human colonoids were prepared from biopsy samples of adult healthy individuals at the Digestive Diseases Research Center of the Washington University, School of Medicine and were grown as previously described (49, 50). Briefly, isolated colonoids were thawed and plated (in 24-well plates) in Matrigel (BD Biosciences) droplets (15 μl) followed by incubation at 37 °C with conditioned media (a 1:1 mixture of the L-WRN cell line and primary culture media [Advanced DMEM/F12; Invitrogen] supplemented with fetal bovine serum [20%], l-glutamine [2 mM], penicillin [100 U/ml], streptomycin [100 μg/ml], Stemolecule Y27632 [10 μM; Reprocell], and SB 431542 [10 μM; Peprotech]). To obtain polarized differentiated colonoid monolayers, cells were plated at density of 5 × 104 cells/well onto 24-well cell culture inserts (Corning) coated with type IV human collagen (Sigma) and then grown for 4 days prior to induction of differentiation by addition of differentiation media (5% conditioned media added with only Y-27632 inhibitor). Differentiated colonoid monolayers were then exposed as indicated to normoxia and hypoxia conditions as mentioned previously.

Carrier-mediated [3H]-TPP and [3H]-thiamin uptake

Initial rates (10 min for in vitro; 30 min for ex vivo; both at 37 °C) of carrier-mediated TPP and free thiamin uptake were examined in normoxic and hypoxic NCM460 cells (in vitro) as well as differentiated colonoid monolayers (ex vivo) incubated in Krebs–Ringer buffer (pH 7.4) containing [3H]-TPP (0.23 μM) or [3H]-thiamin (15 nM). At the end of incubations, cells/monolayers were then washed with ice-cold Krebs–Ringer buffer followed by lysis with NaOH and neutralization with 10 N HCl. The radioactive content was counted using a liquid scintillation counter as described previously (50). Uptake of TPP and free thiamin by their respective and distinct carrier-mediated mechanism was determined by subtracting uptake of [3H]-TPP or free [3H]-thiamin in the presence of a high pharmacological concentration (1 mM) of unlabeled TPP or free thiamin from uptake in their absence; all uptake data points were calculated relative to total protein content (in milligrams) of the different preparations.

siRNA transfection

A well-validated silencer-select siRNA targeting HIF-1α (s6541) and negative control siRNA (catalog no.: 4390843) (44) were obtained from Thermo Fisher Scientific. NCM460 cells were transfected with siRNAs for 24 h using Lipofectamine RNAiMAX transfection reagent (Invitrogen) following the manufacturer's instructions. During transfection, the culture medium containing the siRNA and transfection reagent was changed daily. After transfection, the cells were exposed to normoxic or hypoxic conditions for an additional 16 h.

Isolation of RNA, complementary DNA synthesis, and real-time qPCR assay

Total RNA was isolated from human colonic epithelial NCM460 cells and human differentiated colonoid monolayers using QIAzol Lysis reagent (QIAGEN) and RNeasy Kit (QIAGEN) as previously described (50). The RNA was then converted to complementary DNA using the Verso-cDNA Synthesis Kit (Thermo Fisher Scientific), and levels of mRNA expression of SLC44A4, SLC19A2, SLC19A3, CREB-1, Elf-3, SP-1, GKLF, NF-1, PGK-1, and LDHA were then quantified by real-time qPCR using iQ SYBER Green Super mix (Bio-Rad) in the CFX96 real-time PCR system (Bio-Rad) following the manufacturer's guidelines using gene-specific primers (Table 1). Relative gene expression was quantified by normalizing threshold cycle (Ct) values to the respective GAPDH following 2−ΔΔCt method (51).

Table 1.

List of primer sequences for RT–qPCR

Gene name Forward primers (5′–3′) Reverse primers (5′—3′)
Human cTPPT TGCTGATGCTCATCTTCCTGCG GGACAAAGGTGACCAGTGGGTA
Human THTR-1 GCCAGACCGTCTCCTTGTA TAGAGAGGGCCCACCACAC
Human THTR-2 TTCCTGGATTTACCCCACTG GTATGTCCAAACGGGGAAGA
Human CREB-1 TTAACCATGACCAATGCAGCA TGGTATGTTTGTACGTCTCCAGA
Human Elf-3 TCTTCCCCAGCGATGGTTTTC TCCCGGATGAACTCCCACA
Human SP-1 CCATACCCCTTAACCCCG GAATTTTCACTAATGTTTCCCACC
Human GKLF-4 CCGCTCCATTACCAAGAGCT ATCGTCTTCCCCTCTTTGGC
Human NF-1A GCAGGCCCGAAAACGAAAATA TTTGCCAGAAGTCGAGATGCC
Human GAPDH CGACCACTTTGTCAAGCTCA AGGGGAGATTCAGTGTGGTG
Human PGK-1 TTAAAGGGAAGCGGGTCGTTA TCCATTGTCCAAGCAGAATTTGA
Human LDHA CTCCAAGCTGGTCATTATCACG AGTTCGGGCTGTATTTTACAACA

Isolation of protein and immunoblotting assay

Total protein was isolated from human colonic NCM460 cells using radioimmunoprecipitation assay buffer (Sigma) with protease inhibitor cocktail, and an equal amount (45 μg) of the proteins was loaded on a NuPAGE 4 to 12% Bris–Tris gradient minigels (Invitrogen) as previously described (47). The proteins were then blotted onto polyvinylidene difluoride membranes and probed with anti-cTPPT (1:500), anti-THTR-1 (1:1000), anti-THTR-2 (1:1000), anti-HIF-1α (1:500), or anti-HIF-2α (1:500) antibodies and simultaneously with anti-GAPDH (1:2000) primary antibodies. Specificity of the anti-cTPPT, THTR-1, and THTR-2 antibodies was validated in our laboratory previously using different approaches that include overexpression of tag protein or gene silencing (52, 53). Other antibodies were validated by either the respective company or by the other investigators using knockout animals and/or gene knockdown approaches. The immune-reactive bands from the blot were then identified with corresponding anti-rabbit IR-800 dye (1:30,000) and antimouse IR-680 dye (1:30,000) secondary antibodies incubation for 1 h at room temperature. Relative expression of specific immunoreactive band was calculated by comparing the fluorescence intensities in an Odyssey infrared imaging system (LI-COR) with respect to corresponding GAPDH.

Luciferase reporter assay for promoter activity

Three micrograms per milliliter of SLC44A4, SLC19A2, and SLC19A3 full-length as well as minimal promoter constructs (previously cloned and characterized in our laboratory; (45, 46, 47)) together with 100 ng of thymidine kinase promoter-Renilla luciferase plasmid (Promega) were transiently transfected into human colonic epithelial NCM460 cells utilizing Lipofectamine 2000 reagent (obtained from Life Technologies) for a period of 48 h, as described previously (45, 46, 47, 50). Cells were then exposed to chamber-induced hypoxic or normoxic conditions for additional 16 h and then lysed with passive lysis buffer for further analysis. All Renilla-normalized firefly luciferase promoter activities were assessed utilizing a Glomax 20/20 Luminometer (Promega) using the dual-luciferase assay system (Promega).

Statistical analysis

All carrier-mediated TPP and thiamin uptake, qPCR, immunoblotting quantification, and luciferase reporter assay data were calculated as means ± standard error. The graphical data in all the figures were presented as percentage relative to simultaneously performed controls using GraphPad Prism 8 software (GraphPad Software, Inc). Statistical analyses were carried out by unpaired Student's t test, and p < 0.05 was considered as being statistically significant.

Data availability

All data are contained within the article.

Conflict of interest

The authors declare that they have no conflicts of interest with the contents of this article.

Acknowledgments

Author contributions

S. S. and H. M. S. conceptualization; S. S., J. M. R., and R. D. S. methodology; S. S. and K. R. software; S. S., K. R., and J. M. R. validation; S. S. and K. R. investigation; S. S., K. R., and R. D. S. data curation; S. S. writing–original draft; S. S., K. R., J. M. R., R. D. S., J. M. F., and H. M. S. writing–review & editing; S. S. visualization; H. M. S. supervision; J. M. F. and H. M. S. funding acquisition.

Funding and additional information

This work was supported by grants from the Department of Veterans Affairs (I01BX001142 to H. M. S. and 5I01BX001469-05 to J. M. F.) and the National Institutes of Health (DK5606 and AA018071 to H. M. S. and AI089894 and AI126887 to J. M. F. and by the National Institutes of Health Washington University Digestive Diseases Research Core Centers grant National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health [grant no.: P30 DK052574]). The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.

Edited by Ruma Banerjee

References

  • 1.Singleton C.K., Martin P.R. Molecular mechanisms of thiamine utilization. Curr. Mol. Med. 2001;1:197–207. doi: 10.2174/1566524013363870. [DOI] [PubMed] [Google Scholar]
  • 2.Vemuganti R., Kalluri H., Yi J.H., Bowen K.K., Hazell A.S. Gene expression changes in thalamus and inferior colliculus associated with inflammation, cellular stress, metabolism and structural damage in thiamine deficiency. Eur. J. Neurosci. 2006;23:1172–1188. doi: 10.1111/j.1460-9568.2006.04651.x. [DOI] [PubMed] [Google Scholar]
  • 3.Hazell A.S., Butterworth R.F. Update of cell damage mechanisms in thiamine deficiency: Focus on oxidative stress, excitotoxicity and inflammation. Alcohol. Alcohol. 2009;44:141–147. doi: 10.1093/alcalc/agn120. [DOI] [PubMed] [Google Scholar]
  • 4.Hernandez-Vazquez A.J., Garcia-Sanchez J.A., Moreno-Arriola E., Salvador-Adriano A., Ortega-Cuellar D., Velazquez-Arellano A. Thiamine deprivation produces a liver ATP deficit and metabolic and genomic effects in mice: Findings are parallel to those of biotin deficiency and have implications for energy disorders. J. Nutrigenet. Nutrigenomics. 2016;9:287–299. doi: 10.1159/000456663. [DOI] [PubMed] [Google Scholar]
  • 5.Todd K.G., Butterworth R.F. Early microglial response in experimental thiamin deficiency: An immunohistochemical analysis. Glia. 1999;25:190–198. doi: 10.1002/(sici)1098-1136(19990115)25:2<190::aid-glia9>3.0.co;2-b. [DOI] [PubMed] [Google Scholar]
  • 6.Fernandez-Banares F., Abad-Lacruz A., Xiol X., Gine J.J., Dolz C., Cabre E., Esteve M., Gonzalez-Huix F., Gassull M.A. Vitamin status in patients with inflammatory bowel disease. Am. J. Gastroenterol. 1989;84:744–748. [PubMed] [Google Scholar]
  • 7.Woolum J.A., Abner E.L., Kelly A., Thompson Bastin M.L., Morris P.E., Flannery A.H. Effect of thiamine administration on lactate clearance and mortality in patients with septic shock. Crit. Care Med. 2018;46:1747–1752. doi: 10.1097/CCM.0000000000003311. [DOI] [PubMed] [Google Scholar]
  • 8.Tallaksen C.M., Bøhmer T., Bell H. Blood and serum thiamin and thiamin phosphate esters concentration in patients with alcohol dependence syndrome. Alcohol. Clin. Exp. Res. 1992;16:320–325. doi: 10.1111/j.1530-0277.1992.tb01384.x. [DOI] [PubMed] [Google Scholar]
  • 9.Leevy C.M., Baker H. Vitamins and alcoholism. Am. J. Clin. Nutr. 1968;21:1325–1328. doi: 10.1093/ajcn/21.11.1325. [DOI] [PubMed] [Google Scholar]
  • 10.Albaugh V.L., Williams D.B., Aher C.V., Spann M.D., English W.J. Prevalence of thiamine deficiency is significant in patients undergoing primary bariatric surgery. Surg. Obes. Relat. Dis. 2021;17:653–658. doi: 10.1016/j.soard.2020.11.032. [DOI] [PubMed] [Google Scholar]
  • 11.Thornalley P.J., Babaei-Jadidi R., Al Ali H., Rabbani N., Antonysunil A., Larkin J., Ahmed A., Rayman G., Bodmer C.W. High prevalence of low plasma thiamin concentration in diabetes linked to a marker of vascular disease. Diabetologia. 2007;125:771–774. doi: 10.1007/s00125-007-0771-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Mallat J., Lemyze M., Thevenin D. Do not forget to give thiamine to your septic shock patient. J. Thorac. Dis. 2016;8:1062–1066. doi: 10.21037/jtd.2016.04.32. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Neufeld E.J., Fleming J.C., Tartaglini E., Steinkamp M.P. Thiamin-responsive megaloblastic anemia syndrome: A disorder of high-affinity thiamin transport. Blood Cells Mol. Dis. 2001;27:135–138. doi: 10.1006/bcmd.2000.0356. [DOI] [PubMed] [Google Scholar]
  • 14.Costantini A., Pala M.I. Thiamine and fatigue in inflammatory bowel diseases: An open-label pilot study. J. Altern. Complement. Med. 2013;19:704–708. doi: 10.1089/acm.2011.0840. [DOI] [PubMed] [Google Scholar]
  • 15.Magnúsdóttir S., Ravcheev D., de Crécy-Lagard V., Thiele I. Systematic genome assessment of B-vitamin biosynthesis suggests co-operation among gut microbes. Front. Genet. 2015;6:148. doi: 10.3389/fgene.2015.00148. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Arumugam M., Raes J., Pelletier E., Le Paslier D., Yamada T., Mende D.R., Fernandes G.R., Tap J., Bruls T., Batto J.M., Bertalan M., Borruel N., Casellas F., Fernandez L., Gautier L., et al. Enterotypes of the human gut microbiome. Nature. 2011;473:174–180. doi: 10.1038/nature09944. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Wong O.M. In: The Large Intestine; its Role in Mammalian Nutrition and Homeostasis. Wong O.M., editor. Wiley and Sons; New York, NY: 1981. Vitamins; pp. 157–166. [Google Scholar]
  • 18.Najjar V.A., Holt L.E., Jr. Biosynthesis of thiamine in man and its implications in human nutrition. JAMA. 1943;123:683. [Google Scholar]
  • 19.Said H.M., Ortiz A., Subramanian V.S., Neufeld E.J., Moyer M.P., Dudeja P.K. Mechanism of thiamin uptake by human coloncytes: Studies with cultured colonic epithelial cell line NCM460. Am. J. Physiol. Gastrointest. Liver Physiol. 2001;281:G144–G150. doi: 10.1152/ajpgi.2001.281.1.G144. [DOI] [PubMed] [Google Scholar]
  • 20.Rindi G., Laforenza U. Thiamine intestinal transport and related issues: Recent aspects. Proc. Soc. Exp. Biol. Med. 2000;224:246–255. doi: 10.1046/j.1525-1373.2000.22428.x. [DOI] [PubMed] [Google Scholar]
  • 21.Said H.M., Nexo E. Gastrointestinal handling of water-soluble vitamins. Compr. Physiol. 2018;8:1291–1311. doi: 10.1002/cphy.c170054. [DOI] [PubMed] [Google Scholar]
  • 22.Yoshii K., Hosomi K., Sawane K., Kunisawa J. Metabolism of dietary and microbial vitamin B family in the regulation of host immunity. Front. Nutr. 2019;6:48. doi: 10.3389/fnut.2019.00048. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Kasper H. Vitamin absorption in the colon. Am. J. Proctol. 1970;21:341–345. [PubMed] [Google Scholar]
  • 24.Guerrant N.B., Dutcher R.A. The assay of vitamins B and gas influenced by coprophagy. J. Biol. Chem. 1932;98:225–235. [Google Scholar]
  • 25.Nabokina S.M., Said H.M. A high-affinity and specific carrier-mediated mechanism for uptake of thiamin pyrophosphate by human colonic epithelial cells. Am. J. Physiol. Gastrointest. Liver Physiol. 2012;303:G389–G395. doi: 10.1152/ajpgi.00151.2012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Nabokina S.M., Inoue K., Subramanian V.S., Valle J.E., Yuasa H., Said H.M. Molecular identification and functional characterization of the human colonic thiamine pyrophosphate transporter. J. Biol. Chem. 2014;289:4405–4416. doi: 10.1074/jbc.M113.528257. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Nabokina S.M., Ramos M.B., Said H.M. Mechanism(s) involved in the colon-specific expression of the thiamine pyrophosphate (TPP) transporter. PLoS One. 2016;11 doi: 10.1371/journal.pone.0149255. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Zhao R., Gao F., Goldman I.D. Molecular cloning of human thiamin pyrophosphokinase. Biochim. Biophys. Acta. 2001;1517:320–322. doi: 10.1016/s0167-4781(00)00264-5. [DOI] [PubMed] [Google Scholar]
  • 29.Anwar A., Marini M., Abruzzo P.M., Bolotta A., Ghezzo A., Visconti P., Thornalley P.J., Rabbani N. Quantitation of plasma thiamine, related metabolites and plasma protein oxidative damage markers in children with autism spectrum disorder and healthy controls. Free Radic. Res. 2016;50:S85–S90. doi: 10.1080/10715762.2016.1239821. [DOI] [PubMed] [Google Scholar]
  • 30.McLaren D.S., Docherty M.A., Boyd D.H. Plasma thiamin pyrophosphate and erythrocyte transketolase in chronic alcoholism. Am. J. Clin. Nutr. 1981;34:1031–1033. doi: 10.1093/ajcn/34.6.1031. [DOI] [PubMed] [Google Scholar]
  • 31.Shah Y.M. The role of hypoxia in intestinal inflammation. Mol. Cell. Pediatr. 2016;3:1. doi: 10.1186/s40348-016-0030-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Taylor C.T. Hypoxia in the gut. Cell. Mol. Gastroenterol. Hepatol. 2017;5:61–62. doi: 10.1016/j.jcmgh.2017.09.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Colgan S.P., Campbell E.L., Kominsky D.J. Hypoxia and mucosal inflammation. Annu. Rev. Pathol. 2016;11:77–100. doi: 10.1146/annurev-pathol-012615-044231. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Choi S., Chung H., Hong H., Kim S.Y., Kim S.E., Seoh J.Y., Moon C.M., Yang E.G., Oh E.S. Inflammatory hypoxia induces syndecan-2 expression through IL-1β -mediated FOXO3a activation in colonic epithelia. FASEB J. 2017;31:1516–1530. doi: 10.1096/fj.201601098R. [DOI] [PubMed] [Google Scholar]
  • 35.Morote-Garcia J.C., Rosenberger P., Nivillac N.M., Coe I.R., Eltzschig H.K. Hypoxia-inducible factor-dependent repression of nucleoside transporter 2 attenuates mucosal inflammation during intestinal hypoxia. Gastroenterology. 2009;136:607–618. doi: 10.1053/j.gastro.2008.10.037. [DOI] [PubMed] [Google Scholar]
  • 36.Mastrogiannaki M., Matak P., Keith B., Simon M.C., Vaulont S., Peyssonnaux C. HIF-2α, but not HIF-1α, promotes iron absorption in mice. J. Clin. Invest. 2009;119:1159–1166. doi: 10.1172/JCI38499. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Ullah M.S., Davies A.J., Halestrap A.P. The plasma membrane lactate transporter MCT4, but not MCT1, is up - regulated by hypoxia through a HIF-1α - dependent mechanism. J. Biol. Chem. 2006;281:9030–9037. doi: 10.1074/jbc.M511397200. [DOI] [PubMed] [Google Scholar]
  • 38.Sweet R., Paul A., Zastre J. Hypoxia induced upregulation and function of the thiamine transporter, SLC19A3 in a breast cancer cell line. Cancer Biol. Ther. 2010;10:1101–1111. doi: 10.4161/cbt.10.11.13444. [DOI] [PubMed] [Google Scholar]
  • 39.Zheng W., Kuhlicke J., Jäckel K., Eltzschig H.K., Singh A., Sjöblom M., Riederer B., Weinhold C., Seidler U., Colgan S.P., Karhausen J. Hypoxia inducible factor-1 (HIF-1)-mediated repression of cystic fibrosis transmembrane conductance regulator (CFTR) in the intestinal epithelium. FASEB J. 2009;23:204–213. doi: 10.1096/fj.08-110221. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Onishi Y., Hiraiwa M., Kamada H., Iezaki T., Yamada T., Kaneda K., Hinoi E. Hypoxia affects Slc7a5 expression through HIF-2α in differentiated neuronal cells. FEBS. Open Bio. 2019;9:241–247. doi: 10.1002/2211-5463.12559. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Firth J.D., Ebert B.L., Pugh C.W., Ratcliffe P.J. Oxygen-regulated control elements in the phosphoglycerate kinase 1 and lactate dehydrogenase A genes: Similarities with the erythropoietin 3' enhancer. Proc. Natl. Acad. Sci. U. S. A. 1994;91:6496–6500. doi: 10.1073/pnas.91.14.6496. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Giatromanolaki A., Sivridis E., Kouskoukis C., Gatter K.C., Harris A.L., Koukourakis M.I. Hypoxia-inducible factors 1alpha and 2alpha are related to vascular endothelial growth factor expression and a poorer prognosis in nodular malignant melanomas of the skin. Melanoma Res. 2003;13:493–501. doi: 10.1097/00008390-200310000-00008. [DOI] [PubMed] [Google Scholar]
  • 43.Cummins E.P., Taylor C.T. Hypoxia-responsive transcription factors. Pflugers Arch. 2005;450:363–371. doi: 10.1007/s00424-005-1413-7. [DOI] [PubMed] [Google Scholar]
  • 44.Sasagawa T., Nagamatsu T., Morita K., Mimura N., Iriyama T., Fujii T., Shibuya M. HIF-2α, but not HIF-1α, mediates hypoxia-induced up-regulation of Flt-1 gene expression in placental trophoblasts. Sci. Rep. 2018;26:17375. doi: 10.1038/s41598-018-35745-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Nabokina S.M., Ramos M.B., Valle J.E., Said H.M. Regulation of basal promoter activity of the human thiamine pyrophosphate transporter SLC44A4 in human intestinal epithelial cells. Am. J. Physiol. Cell Physiol. 2015;308:C750–C757. doi: 10.1152/ajpcell.00381.2014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Reidling J.C., Said H.M. In vitro and in vivo characterization of the minimal promoter region of the human thiamin transporter SLC19A2. Am. J. Physiol. Cell Physiol. 2003;285:C633–C641. doi: 10.1152/ajpcell.00076.2003. [DOI] [PubMed] [Google Scholar]
  • 47.Nabokina S.M., Said H.M. Characterization of the 5'-regulatory region of the human thiamin transporter SLC19A3: In vitro and in vivo studies. Am. J. Physiol. Gastrointest. Liver Physiol. 2004;287:G822–G829. doi: 10.1152/ajpgi.00234.2004. [DOI] [PubMed] [Google Scholar]
  • 48.Jiang Y., Xue Z.H., Shen W.Z., Du K.M., Yan H., Yu Y., Peng Z.G., Song M.G., Tong J.H., Chen Z., Huang Y., Lübbert M., Chen G.Q. Desferrioxamine induces leukemic cell differentiation potentially by hypoxia-inducible factor-1 alpha that augments transcriptional activity of CCAAT/enhancer-binding protein-alpha. Leukemia. 2005;19:1239–1247. doi: 10.1038/sj.leu.2403734. [DOI] [PubMed] [Google Scholar]
  • 49.Sheikh A., Tumala B., Vickers T.J., Alvarado D., Ciorba M.A., Bhuiyan T.R., Qadri F., Singer B.B., Fleckenstein J.M. CEACAMs serve as toxin-stimulated receptors for enterotoxigenic Escherichia coli. Proc. Natl. Acad. Sci. U. S. A. 2020;117:29055–29062. doi: 10.1073/pnas.2012480117. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Ramamoorthy K., Sabui S., Srinivasan P., Al-Juburi S., Pham Q., Chu B.D., Simoes R.D., Fleckenstein J.M., Said H.M. Effect of chronic alcohol exposure on gut vitamin B7 uptake: Involvement of epigenetic mechanisms and effect of alcohol metabolites. Am. J. Physiol. Gastrointest. Liver Physiol. 2021;321:G123–G133. doi: 10.1152/ajpgi.00144.2021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Livak K.J., Schmittgen T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  • 52.Anandam K.Y., Sabui S., Thompson M.M., Subramanian S., Said H.M. Enterohemorrhagic Escherichia coli infection inhibits colonic thiamin pyrophosphate uptake via transcriptional mechanism. PLoS One. 2019;14 doi: 10.1371/journal.pone.0224234. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Anandam K.Y., Srinivasan P., Yasujima T., Al-Juburi S., Said H.M. Proinflammatory cytokines inhibit thiamin uptake by human and mouse pancreatic acinar cells: Involvement of transcriptional mechanism(s) Am. J. Physiol. Gastrointest. Liver Physiol. 2021;320:G108–G116. doi: 10.1152/ajpgi.00361.2020. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All data are contained within the article.


Articles from The Journal of Biological Chemistry are provided here courtesy of American Society for Biochemistry and Molecular Biology

RESOURCES