Table 1.
Previously reported indels
| Gene | Variant | Type | COSMIC ID | Primary site |
|---|---|---|---|---|
| ASXL1 | G>G/GC | insertion | 110708 | haematopoietic and lymphoid tissue |
| ASXL1 | AC>AC/A | deletion | 307360 | haematopoietic and lymphoid tissue |
| BCOR | GT>GT/G | deletion | 5453546 | large intestine |
| DNMT3A | TC>TC/T | deletion | 1583095 | haematopoietic and lymphoid tissue |
| FBXW7 | CA>CA/C | deletion | 5007903 | large intestine |
| FLT3 | T>T/TTCATATTCTCTGAAATCAACGTAG | insertion | 1317912 | haematopoietic and lymphoid tissue |
| FLT3 | T>T/TTCATATTCTCTGAAATCAACGTAG | insertion | 1317912 | haematopoietic and lymphoid tissue |
| FLT3 | T>T/TTCATATTCTCTGAAATCAACGTAG | insertion | 1317912 | haematopoietic and lymphoid tissue |
| KDM6A | TA>TA/T | deletion | 255005 | urinary tract |
| NPM1 | C>C/CTCTG | insertion | 1319222 | haematopoietic and lymphoid tissue |
| NPM1 | C>C/CTCTG | insertion | 1319222 | haematopoietic and lymphoid tissue |
| NPM1 | C>C/CTCTG | insertion | 1319222 | haematopoietic and lymphoid tissue |
| PTEN | AC>AC/A | deletion | 125653 | endometrium |
| PTEN | TC>TC/T | deletion | 5176 | Endometrium |
| RUNX1 | GC>GC/G | deletion | 444420 | breast |
| TET2 | TA>TA/T | deletion | 211709 | haematopoietic and lymphoid tissue |
| TET2 | TG>TG/T | deletion | 120173 | haematopoietic and lymphoid tissue |
| TET2 | CT>CT/C | deletion | 4170105 | haematopoietic and lymphoid tissue |
| TET2 | TC>TC/T | deletion | 87187 | haematopoietic and lymphoid tissue |