Skip to main content
. 2022 Feb 4;11:e70207. doi: 10.7554/eLife.70207

Key resources table.

Reagent type (species) or resource Designation Source or reference Identifiers Additional information
Strain, strain background (chikungunya virus) CHIKV Dr. P. Roques (CEA, Fontenay-aux-Roses, France) KT449801.1 Isolate LR2006-OPY1
Chemical compound, drug TRIzol Sigma-Aldrich Cat# 15596026
Chemical compound, drug MitoTEMPO Sigma-Aldrich Cat#1334850-99-5
Commercial assay, kit TruSeq RNA Sample Prep Kit (v2) Illumina SCR_010233
Commercial assay, kit TruSeq Stranded mRNA library preparation kit Illumina SCR_010233
Commercial assay, kit QIAamp DNA Micro Kit QIAGEN Cat# 56304
Commercial assay, kit iScript cDNA Synthesis Kit Bio-Rad Cat# 1708890
Commercial assay, kit Q5 Hot Start High-Fidelity DNA Polymerase NEB Cat# M0493S Enzyme
Other Illumina HiSeq 2000 Sequencer Illumina RRID:SCR_010233 Sequencing platform
Other NextSeq 550 Illumina RRID:SCR_016381 Sequencing platform
Other NovaSeq 6000 Illumina RRID:SCR_016387 Sequencing platform
Software, algorithm k-mer_mining_SRA GitHub https://github.com/CameronBishop/k-mer_mining_SRA
Cell line (Cercopithecus aethiops) Vero cells ATCC RRID:CVCL_0059
Cell line (Aedes albopictus) C6/36 cells ATCC RRID:CVCL_Z230
Strain, strain background (Mus musculus) C57BL/6J Animal Resources Centre (Canning Vale, WA, Australia) IMSR_JAX:000664
Strain, strain background (M. musculus) C57BL/6N The Jackson Laboratory Stock no. 005304
Strain, strain background (M. musculus) C57BL/6-Gzma-/- Peter MacCallum Cancer Centre, Melbourne, Victoria, Australia Knockout mouse
Strain, strain background (M. musculus) C57BL/6J-Gzmb-/- Peter MacCallum Cancer Centre, Melbourne, Victoria, Australia Knockout mouse
Strain, strain background (M. musculus) C57BL/6J-GzmaS211A The Australian Phenomics Network, Monash University, Melbourne, Australia (this paper) Mutant mouse
Strain, strain background (M. musculus) C57BL/6NNnt8-12 The Australian Phenomics Network, Monash University, Melbourne, Australia (this paper) Knockout mouse
Strain, strain background (M. musculus) C57BL/6J-Ifnar-/- Dr P. Hertzog (Monash University, Melbourne, Australia) Knockout mouse
Strain, strain background (M. musculus) C57BL/6-Il28ra-/- Bristol-Myers Squibb (PMID:25901316) Knockout mouse
Sequence-based reagent Nnt_RTPCR_F1 This paper PCR primers AACAGTGCAAGGAGGTGGAC
Sequence-based reagent Nnt_RTPCR_R1 This paper PCR primers GTGCCAAGGTAAGCCACAAT
Software, algorithm FastQC Babraham Institute RRID:SCR_014583
Software, algorithm MultiQC PMID:27312411 RRID:SCR_014982
Software, algorithm Cutadapt DOI: https://doi.org/10.14806/ej.17.1.200 RRID:SCR_011841
Software, algorithm STAR PMID:23104886 RRID:SCR_004463
Software, algorithm RSEM PMID:21816040 RRID:SCR_013027
Software, algorithm EdgeR PMID:27280887 RRID:SCR_012802
Software, algorithm ‘Ingenuity Pathway Analysis’ (IPA) QIAGEN RRID:SCR_008653
Software, algorithm Cytoscape PMID:14597658 RRID:SCR_003032
Software, algorithm STRING PMID:30476243 RRID:SCR_005223
Software, algorithm ‘Gene Set Enrichment Analysis’ (GSEA) PMID:16199517 RRID:SCR_003199
Software, algorithm ‘Integrative Genomics Viewer‘ (IGV) PMID:21221095 RRID:SCR_011793
Software, algorithm minimap2 PMID:29750242 RRID:SCR_018550
Software, algorithm BigQuery Google Cloud Platform RRID:SCR_001011
Software, algorithm fasterq-dump SRA tool kit sra-tools v 2.9.1