KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Bacterial and Virus Strains | ||
|
| ||
| OP50 | CGC | N/A |
| HT115 | CGC | N/A |
| DH5α | Invitrogen | N/A |
|
| ||
| Chemicals, Peptides, and Recombinant Proteins | ||
|
| ||
| (+)-5-Fluorodeoxyuridine (FUDR) | Spectrum Chemical | F2026-10GMBL |
| Agarose, low melting | Sigma-Aldrich | A9414-10G |
| Alexa Fluor 488 Phalloidin | Life Technologies | A12380 |
| Bacto Peptone | Fisher Scientific | DF0118072 |
| BD Difco granulated agar | VWR | 90000-782 |
| Calcium chloride dihydrate | VWR | 97061-904 |
| Carbenicillin | BioPioneer | C0051-25 |
| Chloroform | Sigma-Aldrich | 34854 |
| Cholesterol | Sigma-Aldrich | 57-88-5 |
| IPTG dioxane free | Denville Scientific | CI8280-4 |
| Isopropanol | Fisher Scientific | AC327272500 |
| LB Broth Miller | Fisher Scientific | BP1426500 |
| Magnesium sulfate heptahydrate | VWR | EM-MX0070-3 |
| Potassium phosphate dibasic | VWR | EM-PX1570-2 |
| Potassium phosphate monobasic | VWR | EM-PX1565-5 |
| Sodium Chloride | EMD Millipore | SX0420-5 |
| Sodium phosphate dibasic | VWR | 71003-472 |
| Tetracycline hydrochloride | Sigma-Aldrich | T7660-5G |
| Trizol | Fisher Scientific | 15596018 |
| Tunicamycin | Millipore | 654380 |
|
| ||
| Critical Commercial Assays | ||
|
| ||
| QIAquick PCR Purification Kit | QIAGEN | 28106 |
| QIAprep Spin Miniprep Kit | QIAGEN | 27106 |
|
| ||
| Deposited Data | ||
|
| ||
| RNA-seq | Annotare 2.0 ArrayExpress | E-MTAB-9771 |
|
| ||
| Experimental Models: Organisms/Strains | ||
|
| ||
| C. elegans: Bristol (N2) strain as wild type (WT) | CGC | N2 |
| C. elegans: AGD927: uthIs270 [rab-3p::Xbp-1 s, myo-2p::tdTomato] | Taylor and Dillin, 2013 | N/A |
| C. elegans: AGD928: uthIs270[rab-3p::Xbp-1 s, myo-2p::tdTomato]; zcIs4[hsp-4p::GFP] | Taylor and Dillin, 2013 | N/A |
| C. elegans: AGD1237: N2, unc-30(ok613) IV; uthIs270[rab-3p::Xbp-1 s, myo-2p::tdTomato]; zcIs4[hsp-4p::GFP] | This study | N/A |
| C. elegans: AGD1497: N2, uthIs270[rab-3p::Xbp-1 s, myo-2p::tdTomato]; zcIs4[hsp-4p::GFP];tbh1(n3247) | This study | N/A |
| C. elegans: AGD1498: N2, uthIs270[rab-3p::Xbp-1 s, myo-2p::tdTomato]; zcIs4[hsp-4p::GFP]; ttx-3(ks5) | This study | N/A |
| C. elegans: AGD1500: N2, uthIs270[rab-3p::Xbp-1 s, myo-2p::tdTomato]; zcIs4[hsp-4p::GFP]; tph1(mg280) | This study | N/A |
| C. elegans: AGD1526: N2, uthIs270[rab-3p::Xbp-1 s, myo-2p::tdTomato]; zcIs4[hsp-4p::GFP] V; cat2(e1112) | This study | N/A |
| C. elegans: AGD1767: N2, uthIs460[dat-1p::Xbp-1 s, myo-2p::tdTomato] | This study | N/A |
| C. elegans: AGD1771: N2, uthIs464[rgef-1p::Xbp-1 s, myo-2p::tdTomato] | This study | N/A |
| C. elegans: AGD2048: dhs-3p::dhs-3::GFP; hjSi158 [vha-6p::SEL-1(1-79)::mCherry::HDELlet-858 3′ UTR] | Daniele et al., 2020 | N/A |
| C. elegans: AGD2049: dat-1(ok157), dhs-3p::dhs-3::GFP; hjSi158[vha-6p::SEL-1(1-79)::mCherry::HDELlet-858 3′ UTR] | This study | N/A |
| C. elegans: AGD2064: N2, uthIs460[dat-1p::Xbp-1 s, myo-2p::tdTomato](#Aa), dhs-3p::dhs-3::GFP; hjSi158[vha-6p::SEL-1(1-79)::mCherry::HDELlet-858 3′ UTR] | This study | N/A |
| C. elegans: AGD2065: N2, dhs-3p::dhs-3::GFP; hjSi158 [vha-6p::SEL-1(1-79)::mCherry::HDELlet-858 3′ UTR]; uthIs270 [rab-3p::Xbp-1 s, myo-2p::tdTomato] | Daniele et al., 2020 | N/A |
| C. elegans: AGD2149: N2, uthIs270[rab-3p::Xbp-1 s, myo-2p::tdTomato]; zcIs4[hsp-4p::GFP]; dop1(vs101) | This study | N/A |
| C. elegans: AGD2207: N2, cat-2(n4547) II; zcls4 [hsp-4p::GFP]V | This study | N/A |
| C. elegans: AGD2209: N2, cat-2(n4547) II; dhs-3p::dhs-3::GFP; hjSi158[vha-6p::SEL-1(1-79)::mCherry::HDELlet-858 3′ UTR] | This study | N/A |
| C. elegans: AGD2147: N2, uthIs270[rab-3p::Xbp-1 s, myo-2p::tdTomato]; zcIs4[hsp-4p::GFP]; mec-3(e1338)IV | This study | N/A |
| C. elegans: AGD2155: N2, uthIs270[rab-3p::Xbp-1 s, myo-2p::tdTomato]; zcIs4[hsp-4p::GFP]; unc-43(n498)IV | This study | N/A |
| C. elegans: AGD2164: N2, uthIs460[dat-1p::xbp-1 s, myo-2p::tdTomato](#Aa); cat-2(n4547) | This study | N/A |
| C. elegans: AGD2275: N2, uthIs460[dat-1p::Xbp-1 s, myo-2p::tdTomato](#Aa); zcls4(hsp-4p::GFP)V | This study | N/A |
| C. elegans: AGD2474: N2, uthIs460[dat-1p::xbp-1 s, myo-2p::tdTomato](#Aa); ldrIs [dhs-3p::dhs-3::GFP + unc-76(+)]; hjSi158[vha-6p::SEL-1(1-79)::mCherry::HDEL::let-858 3′ UTR]; cat-2(n4547) II | This study | N/A |
| C. elegans: AGD2496: N2, tph-1(mg280)II;; zcls4[hsp-4p::GFP]V | This study | This study |
| C. elegans: AGD2503: N2, uthIs501(tph-1p::xbp-1 s::unc-54 UTR; myo-2p::GFP) line1 | This study | This study |
| C. elegans: AGD2504: N2, uthIs502(tph-1p::xbp-1 s::unc-54 UTR; myo-2p::GFP) line2 | This study | This study |
| C. elegans: AGD2505: N2, uthIs503(tph-1p::xbp-1 s::unc-54 UTR; myo-2p::GFP) line3 | This study | This study |
| C. elegans: AGD2506: N2, uthIs501(tph-1p::xbp-1 s::unc-54 UTR; myo-2p::GFP) linel; zcls4[hsp-4p::GFP]V | This study | This study |
| C. elegans: AGD2507: N2, uthIs502(tph-1p::xbp-1 s::unc-54 UTR; myo-2p::GFP) line2; zcls4[hsp-4p::GFP]V | This study | This study |
| C. elegans: AGD2508: N2, uthIs503(tph-1p::xbp-1 s::unc-54 UTR; myo-2p::GFP) line3; zcls4[hsp-4p::GFP]V | This study | This study |
| C. elegans: AGD2686: N2, uthIs460[dat-1p::xbp-1 s, myo-2p::tdTomato], ldrIs[dhs-3p::dhs-3::GFP + unc-76(+)]; hjSi158[vha-6p::SEL-1(1-79)::mCherry::HDEL::let-858 3′ UTR]; tph-1(mg280)II | This study | This study |
| C. elegans: AGD2695: N2, uthIs460[dat-1p::xbp-1 s, myo-2p::tdTomato]; tph-1(mg280) II | This study | This study |
| C. elegans: AGD2713: N2, uthIs503(tph-1p::xbp-1 s::unc-54 UTR; myo-2p::GFP) line3; uthIs460[dat-1p::xbp-1 s, myo-2p::tdTomato] | This study | This study |
| C. elegans: AGD2714: N2, uthIs503(tph-1p::xbp-1 s::unc-54 UTR; myo-2p::GFP) line 3; ldrIs[dhs-3p::dhs-3::GFP + unc-76(+)]; hjSi158 [vha-6p::SEL-1(1-79)::mCherry::HDEL::let-858 3′ UTR]” | This study | This study |
| C. elegans: AGD2715: N2, uthIs503(tph-1p::xbp-1 s::unc-54 UTR; myo-2p::GFP) line3; cat-2(n4547) | This study | This study |
| C. elegans: AGD2716: N2, uthIs503(tph-1p::xbp-1 s::unc-54 UTR; myo-2p::GFP) 57E4; tph-1(mg280) | This study | This study |
| C. elegans: AGD2967: N2, mod-5(n3314)I, zcls4[hsp-4p::GFP]V | This study | This study |
| C. elegans: AGD2968: N2, mod-5(n3314)I, ldrIs [dhs-3p::dhs-3::GFP + unc-76(+)]; hjSi158[vha-6p::SEL-1(1-79)::mCherry::HDEL::let-858 3′ UTR] | This study | This study |
| C. elegans: MT15620: tph-1(mg280) | CGC | GR1321 |
| C. elegans: MT15620: cat-2(n4547) | CGC | MT15620 |
| C. elegans: RM2702: dat-1(ok157) | CGC | RM2702 |
| C. elegans: SJ4005: zcls4(hsp-4p::GFP)V | Taylor and Dillin, 2013 | SJ4005 |
|
| ||
| Oligonucleotides | ||
|
| ||
| RHS427 xbp-1T qPCR F | cacctccatcaacaacaacat | Forward primer to qPCR xbp-1 total |
| RHS428 xbp-1T qPCR R | aaccgtctgctccttcctcaa | Reverse primer to qPCR xbp-1 total |
| RHS429 xbp-1 s qPCR F | cgtgcctttgaatcagcagtg | Forward primer to qPCR xbp-1 spliced |
| RHS430 xbp-1 s qPCR R | cgaggtgtccatcttcttgtt | Reverse primer to qPCR xbp-1 spliced |
| RHS433 crt-1 qPCR F | atgacgagatggacggagaat | Forward primer to qPCR crt-1 |
| RHS434 crt-1 qPCR R | ctgacttgacctgccacaaat | Reverse primer to qPCR crt-1 |
| RHS435 T14G8.3 qPCF F | gccagtggagccaaaagcaaa | Forward primer to qPCR T14G8.3 |
| RHS436 T14G8.3 qPCR R | ccaagcggttcatagcctctt | Reverse primer to qPCR T14G8.3 |
| RHS473 hsp4 qPCR V2 F | GAATCAACCCTGACGAAGCAG | Forward primer to qPCR hsp-4 |
| RHS474 hsp4 qPCR V2 R | CCTCCGACAGTCTCAATACCC | Reverse primer to qPCR hsp-4 |
| RHS475 ehbp-1 qPCR F | GATCCGTGAAACAGAAGTTGG | forward primer to qPCR ehbp-1 |
| RHS476 ehbp-1 qPCR R | CCCAATTGGTCAATTTCCGAA | reverse primer to qpCR ehbp-1 |
| RHS682 fat-6 qPCR F | TCTACCAGCTCATCTTCGAGGC | forward primer to qPCR fat-6 |
| RHS683 fat-6 qPCR R | GATCACGAG CCCATTCGATGAC | reverse primer to qPCR fat-6 |
| RHS684 fat-7 qPCR F | GGAAGGAGACAGCATTCATTGCG | forward primer to qPCR fat-7 |
| RHS685 fat-7 qPCR R | GTCTTGTGGGAATGTGTGGTGG | reverse primer to qPCR fat-7 |
| RHS529 tphlp-xbpis F | AGGTCGACTCTAGAGGATCC cgcgaattgcggccgacata |
forward primer to PCR tph-1p |
| RHS530 tph1p-xbp1s R | CGTTTTGGATAGTTGCTCAT atgattgaagagagcaatgctac |
reverse primer to PCR tph-1p |
| RHS531 tph1p-xbp1s F2 | gcattgctctcttcaatcatATGAGCAACTATC CAAAACGTATTTA |
Forward primer to PCR xbp-1 s::UTR + vector from pAF18 (3) |
| RHS532 tph1p-xbp1s R2 | tatgtcggccgcaattcgcgGGATCCTCTAG AGTCGACCTG |
reverse primer to PCR xbp-1 s::UTR + vector from pAF18 |
| VR1 | CTGCAGaatgtttctagtcgtttttg | Forward primer to PCR dat-1p from gDNA |
| VR2 | tttttatgggttttggtaggCCCGGG | Reverse primer to PCR dat-1p from gDNA |
| VR3 | CCCGGGATGAGCAACTATCCAAAACG | Forward primer to PCR xbp-1 s::UTR + vector from pAF18 (3) |
| VR4 | TGCAGGCATGCAAGCTTCTGCAG | Reverse primer to PCR xbp-1 s::UTR + vector from pAF18 |
|
| ||
| Recombinant DNA | ||
|
| ||
| pRHS55: tph-1p::xbp-1 scDNA::unc-54 3′ UTR | This study | N/A |
| pVR1: dat-1p::xbp-1 s cDNA::unc-54 3′ UTR | This study | N/A |
| pRT5: pAD1 rgef-1p::xbp-1 s cDNA::unc-54 3′ UTR | Taylor and Dillin, 2013 | N/A |
| pEK1 : myo-2p::GFP::unc-54 3′UTR | This study | N/A |
| pEK2myo-2p::tdtomato::unc-52 3′ UTR | This study | N/A |
|
| ||
| Software and Algorithms | ||
|
| ||
| Zen 2 Blue Edition | Zeiss | N/A - download available from Zeiss website |
| LASX | Leica | N/A - download available from Leica website |