Key resources table.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (Danio rerio) |
TgBAC(nkx6. 1:eGFP)ulg004 |
PMID:26329351 | ZFIN: ZDB-ALT-160205–1 | |
| Genetic reagent (Danio rerio) | Tg(ins:NTR-P2A-mCherry)ulg034 | PMID:29663654 | ZFIN: ZDB-ALT-171122–9 | |
| Genetic reagent (Danio rerio) | Tg(sst1.1:eGFP)ulg054 | This paper | See Zebrafish husbandry and generation of the Tg(sst1.1:eGFP)ulg054 zebrafish line |
|
| Antibody | Anti-GFP (chicken polyclonal) | Aves Labs | GFP-1020 | (1:500) |
| Antibody | Anti-Insulin (guinea pig polyclonal) |
Dako | A0564 | (1:500) |
| Antibody | anti-mCherry/ dsRed (Living Colors Polyclonal) |
Clontech | 632,496 | (1:500) |
| Antibody | anti-Pan-RCFP (Living Colors Polyclonal) |
Clontech | 632,475 | (1:500) |
| Antibody | anti-Somatostatin (rat polyclonal) |
Invitrogen | MA5-16987 | (1:300) |
| Antibody | anti-Somatostatin (rabbit polyclonal) |
Dako | A0566 | (1:300) |
| Antibody | anti-Glucagon (mouse monoclonal) |
Sigma | G2654 | (1:300) |
| Antibody | anti-Urocortin 3 (rabbit polyclonal) |
Phoenix Pharmaceuticals | H-019–29 | (1:300) |
| Antibody | Anti-Pdx1 (guinea pig polyclonal) |
From Chris Wright | (1:200) | |
| Antibody | PCNA | Sigma-Aldrich | P8825 | (1:500) |
| Antibody | Goat anti-Rat IgG (H + L) Cross-Adsorbed, Alexa Fluor 488 |
Invitrogen | A11006 | (1:750) |
| Antibody | Goat anti-Chicken IgY (H + L), Alexa Fluor 488 |
Invitrogen | A-11039 | (1:750) |
| Antibody | Goat anti-Chicken IgY (H + L), Alexa Fluor 568 |
Invitrogen | A-11041 | (1:750) |
| Antibody | Goat anti-Mouse IgG (H + L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 |
Invitrogen | A-11001 | (1:750) |
| Recombinant DNA reagent | p3E-CREERT2 | This paper | plasmid | |
| Recombinant DNA reagent | p5E-MCS | Tol2kit | 228 | plasmid |
| Recombinant DNA reagent | p3E-eGFP | Tol2kit | 366 | plasmid |
| Recombinant DNA reagent | pDestTol2p2A | Tol2kit | 394 | plasmid |
| Recombinant DNA reagent | pDONRP2R-P3 | plasmid | ||
| Sequence-based reagent | O99 | This article | PCR primer | GGGGACAGCTTTCTTGTACAAAGTGG CTGCTAACCATGTTCATGCCTTC |
| Recombinant DNA reagent |
Tg(ubb:loxP- CFP-loxP-zsYellow) |
PMID:21623370 | ZDB-TGCONSTRCT-111115–6 | |
| Sequence-based reagent | O100 | This article | PCR primer | GGGGACAACTTTGTATAATAAAGTTGTCAAGCTGTGGCAGGGAAACCC |
| Sequence-based reagent | IM217 | This article | PCR primer | ttttattaaagtgtttatttggtctcagag |
| Sequence-based reagent | IM256 | This article | PCR primer | AAGAGCACTTCAGATGTCTTCCC |
| Sequence-based reagent | O097 | This article | PCR primer | GTATCTATAGTTGAACATGAAAGCAT |
| Sequence-based reagent | O098 | This article | PCR primer | GGTCACACTGACACAAACAC ACA |
| Sequence-based reagent | pCR8/GW/TOPO | Invitrogen | K250020 | |
| Commercial assay or kit | Gateway LR Clonase II Enzyme mix |
Invitrogen | 11791020 | |
| Commercial assay or kit | Gateway BP Clonase II Enzyme mix |
Invitrogen | 11789020 | |
| Commercial assay or kit | Nextera XT DNA Library kit |
Illumina | FC-131–1024 | |
| Commercial assay or kit | Click-iT EdU Cell Proliferation Kit for Imaging, Alexa Fluor 647 dye |
Invitrogen | C10340 | |
| Chemical compound, drug | 4-Hydroxytamoxifen | Sigma-Aldrich | H7904 | |
| Chemical compound, drug | Nifurpirinol | Sigma-Aldrich | 32,439 | |
| Software, algorithm | Flowing Software 2 |
https://bioscience.fi/services/cell-imaging/flowing-software/ | RRID:SCR_015781 | Version 2.5.1 |
| Software, algorithm | Imaris | Bitplane(http://www.bitplane.com/imaris/imaris) | RRID:SCR_007370 | Version 9.5 |
| Software, algorithm | GraphPad Prism |
GraphPad Prism (https://graphpad.com) |
RRID:SCR_015807 | Version 8 |
| Software, algorithm | DESeq2 | DESeq2(https://bioconductor.org/packages/release/bioc/html/DESeq2.html) | RRID:SCR_015687 | |
| Software, algorithm | WebGestalt | WebGestalt(http://www.webgestalt.org/) | RRID:SCR_006786 |